@prefix rdf: . @prefix : . @prefix dce: . @prefix obi: . @prefix obo: . @prefix owl: . @prefix xml: . @prefix xsd: . @prefix geno: . @prefix rdfs: . @prefix swrl: . @prefix swrlb: . @prefix dcterms: . @prefix protege: . @prefix oboInOwl: . @prefix property: . @prefix urigen-plugin: . @prefix genotype_model: . a owl:Class ; rdfs:label "Both strands"@en ; rdfs:subClassOf . obo:IAO_0000115 "A position that is exactly known." ; a owl:Class ; rdfs:label "Exact position"@en ; rdfs:subClassOf . a owl:Class ; rdfs:label "Positive strand"@en ; rdfs:subClassOf . obo:IAO_0000115 "Superclass for the general concept of a position on a sequence. The sequence is designated with the reference predicate." ; obo:IAO_0000116 "We place the FALDO:Position class under GENO:genomic location, as it represents a type of genomic location with an extent of 1 (i.e.has the same start and end coordinates - representing a single position as opposed to a location spanning a longer region)." ; obo:IAO_0000412 "FALDO" ; a owl:Class ; rdfs:label "Position"@en ; rdfs:subClassOf obo:GENO_0000902 . obo:IAO_0000115 "A region describes a length of sequence with a start position and end position that represents a feature on a sequence, e.g. a gene." ; obo:IAO_0000116 "From what I can tell, feature instances in data whose position is to be defined using FALDO are always mapped to a Region, and then the position of this Region is defined according to its location within some larger reference sequence. The exception may be feature instances that are explicitly part of the reference sequence on which its location is being defined (such that no 'mapping' to a reference is required). This suggests that, conceptually, we can think of a FALDO:Region as a subregion of a reference sequence that is mapped to from a feature of interest, in order to define its position with respect to that reference sequence." ; a owl:Class ; rdfs:label "Region"@en ; rdfs:subClassOf obo:SO_0000110, [ a owl:Class ; owl:intersectionOf ([ a owl:Restriction ; owl:onClass ; owl:onProperty ; owl:qualifiedCardinality "1"^^xsd:nonNegativeInteger ] [ a owl:Restriction ; owl:onClass ; owl:onProperty ; owl:qualifiedCardinality "1"^^xsd:nonNegativeInteger ] ) ], [ a owl:Restriction ; owl:onProperty ; owl:someValuesFrom ], [ a owl:Restriction ; owl:onProperty ; owl:someValuesFrom ] . a owl:Class ; rdfs:label "Negative strand"@en ; rdfs:subClassOf . a owl:Class ; rdfs:comment "Part of the coordinate system denoting on which strand the feature can be found. If you do not yet know which stand the feature is on, you should tag the position with just this class. If you know more you should use one of the subclasses. This means a region described with a '.' in GFF3. A GFF3 unstranded position does not have this type in FALDO -- those are just a 'position'." ; rdfs:label "Stranded position"@en ; rdfs:subClassOf . a owl:ObjectProperty ; rdfs:label "begin"@en ; rdfs:subPropertyOf obo:GENO_0000708 . a owl:ObjectProperty ; rdfs:label "end"@en ; rdfs:subPropertyOf obo:GENO_0000708 . a owl:ObjectProperty ; rdfs:label "location"@en ; rdfs:subPropertyOf obo:GENO_0000708 . a owl:DatatypeProperty ; rdfs:comment "The position value is the offset along the reference where this position is found. Thus the only the position value in combination with the reference determines where a position is." ; rdfs:label "position"@en . obo:IAO_0000115 "The reference is the resource that the position value is anchored to. For example, a contig or chromosome in a genome assembly." ; a owl:ObjectProperty ; rdfs:label "reference (faldo)" ; rdfs:subPropertyOf obo:GENO_0000708 . protege:defaultLanguage a owl:AnnotationProperty . obo:APOLLO_SV_00000008 obo:IAO_0000115 "A planned process that has specified output a software product and that involves the creation of source code."@en ; obo:IAO_0000117 "Mathias Brochhausen"@en, "William R. Hogan"@en ; obo:IAO_0000119 "http://en.wikipedia.org/wiki/Software_development" ; obo:IAO_0000600 "A planned process resulting in a software product involving the creation of source code."@en ; a owl:Class ; rdfs:label "software development"@en ; rdfs:subClassOf obo:OBI_0000011, [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:IAO_0000010 obo:IAO_0000096 ) ] ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:OBI_0000011 [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:IAO_0000010 obo:IAO_0000096 ) ] ] ) ] . obo:APOLLO_SV_00000796 obo:IAO_0000111 "creating a data set"@en ; obo:IAO_0000115 "A planned process that has a data set as its specified output."@en ; obo:IAO_0000117 "William R. Hogan"@en ; obo:IAO_0000118 "data set creation"@en, "dataset creation"@en ; a owl:Class ; rdfs:label "dataset creating"@en ; rdfs:subClassOf obo:OBI_0000011, [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:IAO_0000100 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:OBI_0000011 [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:IAO_0000100 ] ) ] . obo:BFO_0000001 obo:BFO_0000179 "entity" ; obo:BFO_0000180 "Entity" ; obo:IAO_0000112 "Julius Caesar"@en, "Verdi’s Requiem"@en, "the Second World War"@en, "your body mass index"@en ; obo:IAO_0000116 "BFO 2 Reference: In all areas of empirical inquiry we encounter general terms of two sorts. First are general terms which refer to universals or types:animaltuberculosissurgical procedurediseaseSecond, are general terms used to refer to groups of entities which instantiate a given universal but do not correspond to the extension of any subuniversal of that universal because there is nothing intrinsic to the entities in question by virtue of which they – and only they – are counted as belonging to the given group. Examples are: animal purchased by the Emperortuberculosis diagnosed on a Wednesdaysurgical procedure performed on a patient from Stockholmperson identified as candidate for clinical trial #2056-555person who is signatory of Form 656-PPVpainting by Leonardo da VinciSuch terms, which represent what are called ‘specializations’ in [81"@en, "Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf"@en ; obo:IAO_0000600 "An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001])"@en ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "entity"@en . obo:BFO_0000002 obo:BFO_0000179 "continuant" ; obo:BFO_0000180 "Continuant" ; obo:IAO_0000111 "continuant"@en ; obo:IAO_0000115 "An entity that exists in full at any time in which it exists at all, persists through time while maintaining its identity and has no temporal parts."@en ; obo:IAO_0000116 "BFO 2 Reference: Continuant entities are entities which can be sliced to yield parts only along the spatial dimension, yielding for example the parts of your table which we call its legs, its top, its nails. ‘My desk stretches from the window to the door. It has spatial parts, and can be sliced (in space) in two. With respect to time, however, a thing is a continuant.’ [60, p. 240"@en, "Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants"@en ; obo:IAO_0000412 ; obo:IAO_0000600 "A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002])"@en ; obo:IAO_0000601 "if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001])"@en, "if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002])"@en, "if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002])"@en ; obo:IAO_0000602 "(forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] ", "(forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] ", "(forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] ", "(forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "continuant", "continuant"@en ; rdfs:subClassOf obo:BFO_0000001, [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000002 ; owl:onProperty obo:BFO_0000050 ] ; owl:disjointWith obo:BFO_0000003, [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:BFO_0000003 ] . obo:BFO_0000003 obo:BFO_0000179 "occurrent" ; obo:BFO_0000180 "Occurrent" ; obo:IAO_0000115 "An entity that has temporal parts and that happens, unfolds or develops through time."@en ; obo:IAO_0000116 "BFO 2 Reference: every occurrent that is not a temporal or spatiotemporal region is s-dependent on some independent continuant that is not a spatial region"@en, "BFO 2 Reference: s-dependence obtains between every process and its participants in the sense that, as a matter of necessity, this process could not have existed unless these or those participants existed also. A process may have a succession of participants at different phases of its unfolding. Thus there may be different players on the field at different times during the course of a football game; but the process which is the entire game s-depends_on all of these players nonetheless. Some temporal parts of this process will s-depend_on on only some of the players."@en, "Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process."@en, "Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame." ; obo:IAO_0000600 "An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002])"@en ; obo:IAO_0000601 "Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001])"@en, "b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001])"@en ; obo:IAO_0000602 "(forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] ", "(forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "occurrent", "occurrent"@en ; rdfs:subClassOf obo:BFO_0000001, [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000003 ; owl:onProperty obo:BFO_0000050 ] ; owl:disjointWith [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:BFO_0000002 ] . obo:BFO_0000004 obo:BFO_0000179 "ic" ; obo:BFO_0000180 "IndependentContinuant" ; obo:IAO_0000112 "a chair"@en, "a heart"@en, "a leg"@en, "a molecule"@en, "a spatial region"@en, "an atom"@en, "an orchestra."@en, "an organism"@en, "the bottom right portion of a human torso"@en, "the interior of your mouth"@en ; obo:IAO_0000115 "A continuant that is a bearer of quality and realizable entity entities, in which other entities inhere and which itself cannot inhere in anything."@en, "b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002])"@en ; obo:IAO_0000601 "For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001])"@en, "For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002])"@en ; obo:IAO_0000602 "(forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] ", "(forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] ", "(iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "independent continuant", "independent continuant"@en ; rdfs:subClassOf obo:BFO_0000002, [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000004 ; owl:onProperty obo:BFO_0000050 ] ; owl:disjointWith obo:BFO_0000020, obo:BFO_0000031 . obo:BFO_0000015 obo:BFO_0000179 "process" ; obo:BFO_0000180 "Process" ; obo:IAO_0000112 "a process of cell-division, \\ a beating of the heart"@en, "a process of meiosis"@en, "a process of sleeping"@en, "the course of a disease"@en, "the flight of a bird"@en, "the life of an organism"@en, "your process of aging."@en ; obo:IAO_0000115 "An occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t."@en, "p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003])"@en ; obo:IAO_0000116 "BFO 2 Reference: The realm of occurrents is less pervasively marked by the presence of natural units than is the case in the realm of independent continuants. Thus there is here no counterpart of ‘object’. In BFO 1.0 ‘process’ served as such a counterpart. In BFO 2.0 ‘process’ is, rather, the occurrent counterpart of ‘material entity’. Those natural – as contrasted with engineered, which here means: deliberately executed – units which do exist in the realm of occurrents are typically either parasitic on the existence of natural units on the continuant side, or they are fiat in nature. Thus we can count lives; we can count football games; we can count chemical reactions performed in experiments or in chemical manufacturing. We cannot count the processes taking place, for instance, in an episode of insect mating behavior.Even where natural units are identifiable, for example cycles in a cyclical process such as the beating of a heart or an organism’s sleep/wake cycle, the processes in question form a sequence with no discontinuities (temporal gaps) of the sort that we find for instance where billiard balls or zebrafish or planets are separated by clear spatial gaps. Lives of organisms are process units, but they too unfold in a continuous series from other, prior processes such as fertilization, and they unfold in turn in continuous series of post-life processes such as post-mortem decay. Clear examples of boundaries of processes are almost always of the fiat sort (midnight, a time of death as declared in an operating theater or on a death certificate, the initiation of a state of war)"@en ; obo:IAO_0000602 "(iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "process", "process"@en ; rdfs:subClassOf obo:BFO_0000003 . obo:BFO_0000016 obo:BFO_0000179 "disposition" ; obo:BFO_0000180 "Disposition" ; obo:IAO_0000112 "an atom of element X has the disposition to decay to an atom of element Y"@en, "certain people have a predisposition to colon cancer"@en, "children are innately disposed to categorize objects in certain ways."@en, "the cell wall is disposed to filter chemicals in endocitosis and exocitosis"@en, "the cell wall is disposed to filter chemicals in endocytosis and exocytosis"@en ; obo:IAO_0000116 "BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type [89"@en, "BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type."@en ; obo:IAO_0000600 "b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002])"@en ; obo:IAO_0000601 "If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002])"@en ; obo:IAO_0000602 "(forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] ", "(forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "disposition", "disposition"@en ; rdfs:subClassOf obo:BFO_0000017 ; owl:disjointWith obo:BFO_0000023 . obo:BFO_0000017 obo:BFO_0000179 "realizable" ; obo:BFO_0000180 "RealizableEntity" ; obo:IAO_0000112 "the disposition of this piece of metal to conduct electricity."@en, "the disposition of your blood to coagulate"@en, "the function of your reproductive organs"@en, "the role of being a doctor"@en, "the role of this boundary to delineate where Utah and Colorado meet"@en ; obo:IAO_0000115 "A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances."@en ; obo:IAO_0000600 "To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002])"@en ; obo:IAO_0000601 "All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002])"@en ; obo:IAO_0000602 "(forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] ", "(forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "realizable entity", "realizable entity"@en ; rdfs:subClassOf obo:BFO_0000020, [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000017 ; owl:onProperty obo:BFO_0000050 ] ; owl:disjointWith obo:BFO_0000019 . obo:BFO_0000019 obo:BFO_0000179 "quality" ; obo:BFO_0000180 "Quality" ; obo:IAO_0000111 "quality"@en ; obo:IAO_0000112 "the ambient temperature of this portion of air"@en, "the color of a tomato"@en, "the length of the circumference of your waist"@en, "the mass of this piece of gold."@en, "the shape of your nose"@en, "the shape of your nostril"@en ; obo:IAO_0000412 ; obo:IAO_0000600 "a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001])"@en ; obo:IAO_0000601 "If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001])"@en ; obo:IAO_0000602 "(forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] ", "(forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "quality", "quality"@en ; rdfs:subClassOf obo:BFO_0000020, [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000019 ; owl:onProperty obo:BFO_0000050 ] . obo:BFO_0000020 obo:BFO_0000179 "sdc" ; obo:BFO_0000180 "SpecificallyDependentContinuant" ; obo:IAO_0000111 "specifically dependent continuant"@en ; obo:IAO_0000112 "Reciprocal specifically dependent continuants: the function of this key to open this lock and the mutually dependent disposition of this lock: to be opened by this key"@en, "of one-sided specifically dependent continuants: the mass of this tomato"@en, "of relational dependent continuants (multiple bearers): John’s love for Mary, the ownership relation between John and this statue, the relation of authority between John and his subordinates."@en, "the disposition of this fish to decay"@en, "the function of this heart: to pump blood"@en, "the mutual dependence of proton donors and acceptors in chemical reactions [79"@en, "the mutual dependence of the role predator and the role prey as played by two organisms in a given interaction"@en, "the pink color of a medium rare piece of grilled filet mignon at its center"@en, "the role of being a doctor"@en, "the shape of this hole."@en, "the smell of this portion of mozzarella"@en ; obo:IAO_0000115 "A continuant that inheres in or is borne by other entities. Every instance of A requires some specific instance of B which must always be the same."@en, "b is a relational specifically dependent continuant = Def. b is a specifically dependent continuant and there are n > 1 independent continuants c1, … cn which are not spatial regions are such that for all 1 i < j n, ci and cj share no common parts, are such that for each 1 i n, b s-depends_on ci at every time t during the course of b’s existence (axiom label in BFO2 Reference: [131-004])"@en, "b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003])"@en ; obo:IAO_0000116 "Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc."@en ; obo:IAO_0000412 ; obo:IAO_0000602 "(iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] ", "(iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "specifically dependent continuant", "specifically dependent continuant"@en ; rdfs:subClassOf obo:BFO_0000002, [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000020 ; owl:onProperty obo:BFO_0000050 ] ; owl:disjointWith obo:BFO_0000031 . obo:BFO_0000023 obo:BFO_0000179 "role" ; obo:BFO_0000180 "Role" ; obo:IAO_0000112 "John’s role of husband to Mary is dependent on Mary’s role of wife to John, and both are dependent on the object aggregate comprising John and Mary as member parts joined together through the relational quality of being married."@en, "the priest role"@en, "the role of a boundary to demarcate two neighboring administrative territories"@en, "the role of a building in serving as a military target"@en, "the role of a stone in marking a property boundary"@en, "the role of subject in a clinical trial"@en, "the student role"@en ; obo:IAO_0000115 "A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts."@en ; obo:IAO_0000116 "BFO 2 Reference: One major family of examples of non-rigid universals involves roles, and ontologies developed for corresponding administrative purposes may consist entirely of representatives of entities of this sort. Thus ‘professor’, defined as follows,b instance_of professor at t =Def. there is some c, c instance_of professor role & c inheres_in b at t.denotes a non-rigid universal and so also do ‘nurse’, ‘student’, ‘colonel’, ‘taxpayer’, and so forth. (These terms are all, in the jargon of philosophy, phase sortals.) By using role terms in definitions, we can create a BFO conformant treatment of such entities drawing on the fact that, while an instance of professor may be simultaneously an instance of trade union member, no instance of the type professor role is also (at any time) an instance of the type trade union member role (any more than any instance of the type color is at any time an instance of the type length).If an ontology of employment positions should be defined in terms of roles following the above pattern, this enables the ontology to do justice to the fact that individuals instantiate the corresponding universals – professor, sergeant, nurse – only during certain phases in their lives."@en ; obo:IAO_0000600 "b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001])"@en, "b is a role means: b is a realizable entity and b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be and b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001])"@en ; obo:IAO_0000602 "(forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "role", "role"@en ; rdfs:subClassOf obo:BFO_0000017 . obo:BFO_0000031 obo:BFO_0000179 "gdc" ; obo:BFO_0000180 "GenericallyDependentContinuant" ; obo:IAO_0000112 "The entries in your database are patterns instantiated as quality instances in your hard drive. The database itself is an aggregate of such patterns. When you create the database you create a particular instance of the generically dependent continuant type database. Each entry in the database is an instance of the generically dependent continuant type IAO: information content entity."@en, "the pdf file on your laptop, the pdf file that is a copy thereof on my laptop"@en, "the sequence of this protein molecule; the sequence that is a copy thereof in that protein molecule."@en ; obo:IAO_0000115 "A continuant that is dependent on one or other independent continuant bearers. For every instance of A requires some instance of (an independent continuant type) B but which instance of B serves can change from time to time."@en, "b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001])"@en ; obo:IAO_0000602 "(iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "generically dependent continuant", "generically dependent continuant"@en ; rdfs:subClassOf obo:BFO_0000002, [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000031 ; owl:onProperty obo:BFO_0000050 ] . obo:BFO_0000034 a owl:Class ; rdfs:label "function"@en ; rdfs:subClassOf obo:BFO_0000016 . obo:BFO_0000040 obo:BFO_0000179 "material" ; obo:BFO_0000180 "MaterialEntity" ; obo:IAO_0000111 "material entity", "material entity"@en ; obo:IAO_0000112 "a flame"@en, "a forest fire"@en, "a human being"@en, "a hurricane"@en, "a photon"@en, "a puff of smoke"@en, "a sea wave"@en, "a tornado"@en, "an aggregate of human beings."@en, "an energy wave"@en, "an epidemic"@en, "the undetached arm of a human being"@en ; obo:IAO_0000115 "An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time."@en ; obo:IAO_0000116 "BFO 2 Reference: Material entities (continuants) can preserve their identity even while gaining and losing material parts. Continuants are contrasted with occurrents, which unfold themselves in successive temporal parts or phases [60"@en, "BFO 2 Reference: Object, Fiat Object Part and Object Aggregate are not intended to be exhaustive of Material Entity. Users are invited to propose new subcategories of Material Entity."@en, "BFO 2 Reference: ‘Matter’ is intended to encompass both mass and energy (we will address the ontological treatment of portions of energy in a later version of BFO). A portion of matter is anything that includes elementary particles among its proper or improper parts: quarks and leptons, including electrons, as the smallest particles thus far discovered; baryons (including protons and neutrons) at a higher level of granularity; atoms and molecules at still higher levels, forming the cells, organs, organisms and other material entities studied by biologists, the portions of rock studied by geologists, the fossils studied by paleontologists, and so on.Material entities are three-dimensional entities (entities extended in three spatial dimensions), as contrasted with the processes in which they participate, which are four-dimensional entities (entities extended also along the dimension of time).According to the FMA, material entities may have immaterial entities as parts – including the entities identified below as sites; for example the interior (or ‘lumen’) of your small intestine is a part of your body. BFO 2.0 embodies a decision to follow the FMA here."@en, "Elucidation: An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time."@en ; obo:IAO_0000412 , , ; obo:IAO_0000600 "A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002])"@en ; obo:IAO_0000601 "Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002])"@en, "every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002])"@en ; obo:IAO_0000602 "(forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] ", "(forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] ", "(forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] " ; a owl:Class ; rdfs:isDefinedBy ; rdfs:label "material entity", "material entity"@en ; rdfs:subClassOf obo:BFO_0000004 . obo:BFO_0000050 obo:IAO_0000111 "is part of"@en ; obo:IAO_0000112 "my brain is part of my body (continuant parthood, two material entities)"@en, "my stomach cavity is part of my stomach (continuant parthood, immaterial entity is part of material entity)"@en, "this day is part of this year (occurrent parthood)"@en ; obo:IAO_0000115 "a core relation that holds between a part and its whole"@en ; obo:IAO_0000116 "Everything is part of itself. Any part of any part of a thing is itself part of that thing. Two distinct things cannot be part of each other."@en, "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See http://purl.obolibrary.org/obo/ro/docs/temporal-semantics/"@en, "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See https://code.google.com/p/obo-relations/wiki/ROAndTime"@en, """Parthood requires the part and the whole to have compatible classes: only an occurrent can be part of an occurrent; only a process can be part of a process; only a continuant can be part of a continuant; only an independent continuant can be part of an independent continuant; only an immaterial entity can be part of an immaterial entity; only a specifically dependent continuant can be part of a specifically dependent continuant; only a generically dependent continuant can be part of a generically dependent continuant. (This list is not exhaustive.) A continuant cannot be part of an occurrent: use 'participates in'. An occurrent cannot be part of a continuant: use 'has participant'. A material entity cannot be part of an immaterial entity: use 'has location'. A specifically dependent continuant cannot be part of an independent continuant: use 'inheres in'. An independent continuant cannot be part of a specifically dependent continuant: use 'bearer of'."""@en ; obo:IAO_0000118 "part_of"@en ; obo:RO_0001900 obo:RO_0001901 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "is part of", "part of"@en ; rdfs:seeAlso "http://www.obofoundry.org/ro/#OBO_REL:part_of" ; rdfs:subPropertyOf obo:RO_0002131 ; owl:inverseOf obo:BFO_0000051 . obo:BFO_0000051 obo:IAO_0000111 "has part"@en ; obo:IAO_0000112 "my body has part my brain (continuant parthood, two material entities)"@en, "my stomach has part my stomach cavity (continuant parthood, material entity has part immaterial entity)"@en, "this year has part this day (occurrent parthood)"@en ; obo:IAO_0000115 "a core relation that holds between a whole and its part"@en ; obo:IAO_0000116 "Everything has itself as a part. Any part of any part of a thing is itself part of that thing. Two distinct things cannot have each other as a part."@en, "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See http://purl.obolibrary.org/obo/ro/docs/temporal-semantics/"@en, "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See https://code.google.com/p/obo-relations/wiki/ROAndTime"@en, """Parthood requires the part and the whole to have compatible classes: only an occurrent have an occurrent as part; only a process can have a process as part; only a continuant can have a continuant as part; only an independent continuant can have an independent continuant as part; only a specifically dependent continuant can have a specifically dependent continuant as part; only a generically dependent continuant can have a generically dependent continuant as part. (This list is not exhaustive.) A continuant cannot have an occurrent as part: use 'participates in'. An occurrent cannot have a continuant as part: use 'has participant'. An immaterial entity cannot have a material entity as part: use 'location of'. An independent continuant cannot have a specifically dependent continuant as part: use 'bearer of'. A specifically dependent continuant cannot have an independent continuant as part: use 'inheres in'."""@en ; obo:IAO_0000118 "has_part"@en ; obo:RO_0001900 obo:RO_0001901 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "has part", "has part"@en ; rdfs:subPropertyOf obo:RO_0002131 . obo:BFO_0000054 obo:IAO_0000111 "realized in"@en ; obo:IAO_0000112 "this disease is realized in this disease course"@en, "this fragility is realized in this shattering"@en, "this investigator role is realized in this investigation"@en ; obo:IAO_0000118 "is realized by"@en, "realized_in"@en ; obo:IAO_0000600 "[copied from inverse property 'realizes'] to say that b realizes c at t is to assert that there is some material entity d & b is a process which has participant d at t & c is a disposition or role of which d is bearer_of at t& the type instantiated by b is correlated with the type instantiated by c. (axiom label in BFO2 Reference: [059-003])"@en ; a owl:ObjectProperty ; rdfs:comment "Paraphrase of elucidation: a relation between a realizable entity and a process, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ; rdfs:domain obo:BFO_0000017 ; rdfs:isDefinedBy ; rdfs:label "realized in"@en ; rdfs:range obo:BFO_0000015 ; owl:inverseOf obo:BFO_0000055 . obo:BFO_0000055 obo:IAO_0000111 "realizes"@en ; obo:IAO_0000112 "this disease course realizes this disease"@en, "this investigation realizes this investigator role"@en, "this shattering realizes this fragility"@en ; obo:IAO_0000600 "to say that b realizes c at t is to assert that there is some material entity d & b is a process which has participant d at t & c is a disposition or role of which d is bearer_of at t& the type instantiated by b is correlated with the type instantiated by c. (axiom label in BFO2 Reference: [059-003])"@en ; a owl:ObjectProperty ; rdfs:comment "Paraphrase of elucidation: a relation between a process and a realizable entity, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ; rdfs:domain obo:BFO_0000015 ; rdfs:isDefinedBy ; rdfs:label "realizes"@en ; rdfs:range obo:BFO_0000017 . obo:BFO_0000062 obo:IAO_0000111 "preceded by"@en ; obo:IAO_0000115 "x is preceded by y if and only if the time point at which y ends is before or equivalent to the time point at which x starts. Formally: x preceded by y iff ω(y) <= α(x), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ; obo:IAO_0000116 "An example is: translation preceded_by transcription; aging preceded_by development (not however death preceded_by aging). Where derives_from links classes of continuants, preceded_by links classes of processes. Clearly, however, these two relations are not independent of each other. Thus if cells of type C1 derive_from cells of type C, then any cell division involving an instance of C1 in a given lineage is preceded_by cellular processes involving an instance of C. The assertion P preceded_by P1 tells us something about Ps in general: that is, it tells us something about what happened earlier, given what we know about what happened later. Thus it does not provide information pointing in the opposite direction, concerning instances of P1 in general; that is, that each is such as to be succeeded by some instance of P. Note that an assertion to the effect that P preceded_by P1 is rather weak; it tells us little about the relations between the underlying instances in virtue of which the preceded_by relation obtains. Typically we will be interested in stronger relations, for example in the relation immediately_preceded_by, or in relations which combine preceded_by with a condition to the effect that the corresponding instances of P and P1 share participants, or that their participants are connected by relations of derivation, or (as a first step along the road to a treatment of causality) that the one process in some way affects (for example, initiates or regulates) the other."@en ; obo:IAO_0000118 "is preceded by"@en, "preceded_by"@en ; dcterms:source "http://www.obofoundry.org/ro/#OBO_REL:preceded_by" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:domain obo:BFO_0000003 ; rdfs:label "preceded by"@en ; rdfs:range obo:BFO_0000003 ; rdfs:subPropertyOf obo:RO_0002086 ; owl:inverseOf obo:BFO_0000063 ; owl:propertyChainAxiom (obo:BFO_0000050 obo:BFO_0000062 ), (obo:RO_0002091 obo:BFO_0000062 ) . obo:BFO_0000063 obo:IAO_0000111 "precedes"@en ; obo:IAO_0000115 "x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:domain obo:BFO_0000003 ; rdfs:label "precedes"@en ; rdfs:range obo:BFO_0000003 ; rdfs:subPropertyOf obo:RO_0002222 ; owl:propertyChainAxiom (obo:BFO_0000050 obo:BFO_0000063 ) . obo:BFO_0000179 a owl:AnnotationProperty . obo:BFO_0000180 a owl:AnnotationProperty . obo:CHEBI_23367 obo:IAO_0000111 "molecular entity" ; obo:IAO_0000115 "Any constitutionally or isotopically distinct atom, molecule, ion, ion pair, radical, radical ion, complex, conformer etc., identifiable as a separately distinguishable entity." ; obo:IAO_0000116 "Stub class to serve as root of hierarchy for imports of molecular entities from ChEBI ontology.", "We are assuming that every molecular entity has to be completely connected by chemical bonds. This excludes protein complexes, which are comprised of minimally two separate molecular entities. We will follow up with Chebi to ensure this is their understanding as well"@en ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "molecular entity" ; rdfs:subClassOf obo:BFO_0000040 . obo:CHEBI_33696 obo:IAO_0000111 "nucleic acid" ; obo:IAO_0000115 "A macromolecule made up of nucleotide units and hydrolysable into certain pyrimidine or purine bases (usually adenine, cytosine, guanine, thymine, uracil), D-ribose or 2-deoxy-D-ribose and phosphoric acid." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "nucleic acid" ; rdfs:subClassOf obo:CHEBI_33839 . obo:CHEBI_33839 obo:IAO_0000111 "macromolecule" ; obo:IAO_0000115 "A macromolecule is a molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass." ; obo:IAO_0000118 "polymer"@en ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "macromolecule" ; rdfs:subClassOf obo:CHEBI_23367 . obo:CLO_0000001 obo:IAO_0000111 "cell line cell", "cell line cell"@en, "细胞系细胞"@zh ; obo:IAO_0000115 "A cultured cell that is part of a cell line - a stable and homogeneous population of cells with a common biological origin and propagation history in culture"@en, """A cultured cell that is part of a cell line - a stable and homogeneous population of cells with a common biological origin and propagation history in culture """, "一个培养细胞，它是一个细胞株（一个稳定的，同质的细胞群，具有共同的生物学起源和增殖史）的一部分", """一个培养细胞，它是一个细胞株（一个稳定的，同质的细胞群，具有共同的生物学起源和增殖史）的一部分 """ ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "cell line cell", "cell line cell"@en, "细胞系细胞"@zh ; rdfs:subClassOf obo:OBI_0001866, [ a owl:Class ; owl:unionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0001867 ] [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0001867 ] ] ) ] . obo:CLO_0000031 obo:IAO_0000111 "cell line"@en, "细胞系"@zh ; obo:IAO_0000115 "A cultured cell population that represents a genetically stable and homogenous population of cultured cells that shares a common propagation history (i.e. has been successively passaged together in culture).", "A cultured cell population that represents a genetically stable and homogenous population of cultured cells that shares a common propagation history (i.e. has been successively passaged together in culture). "@en, """A cultured cell population that represents a genetically stable and homogenous population of cultured cells that shares a common propagation history (i.e. has been successively passaged together in culture). """, "一个培养细胞群体，其代表具有共同增殖历史（即已经在培养中一起连续传代）的遗传稳定且同质的培养细胞群体。"@zh, """培养的细胞群体代表具有共同繁殖历史（即已经在培养中一起连续传代）的遗传稳定且同质的培养细胞群体。 """ ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "cell line"@en, "细胞系"@zh ; rdfs:subClassOf obo:GENO_0000904, obo:OBI_0001905, [ a owl:Restriction ; owl:onProperty obo:OBI_0000643 ; owl:someValuesFrom obo:CLO_0000001 ], [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom obo:OBI_0100026 ], [ a owl:Restriction ; owl:allValuesFrom obo:CLO_0000001 ; owl:onProperty obo:OBI_0000643 ] . obo:CL_0000000 obo:IAO_0000111 "cell" ; obo:IAO_0000112 "PMID:18089833.Cancer Res. 2007 Dec 15;67(24):12018-25. \"...Epithelial cells were harvested from histologically confirmed adenocarcinomas ..\""@en ; obo:IAO_0000115 "A material entity of anatomical origin (part of or deriving from an organism) that has as its parts a maximally connected cell compartment surrounded by a plasma membrane." ; obo:IAO_0000116 "CL and GO definitions of cell differ based on inclusive or exclusive of cell wall, etc."@en, "We struggled with this definition. We are worried about circularity. We also considered requiring the capability of metabolism."@en ; obo:IAO_0000412 ; oboInOwl:hasDbXref "CALOHA:TS-2035", "FMA:68646", "GO:0005623", "KUPO:0000002", "MESH:D002477", "VHOG:0001533", "WBbt:0004017", "XAO:0003012" ; a owl:Class ; rdfs:comment "Stub class to serve as root of hierarchy for imports of cell types from CL or other cell terminologies." ; rdfs:label "cell" ; rdfs:subClassOf obo:UBERON_0000061 . obo:CL_0000001 obo:IAO_0000111 "primary cultured cell" ; obo:IAO_0000115 "A cultured cell that is freshly isolated from a organismal source, or derives in culture from such a cell prior to the culture being passaged." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "primary cultured cell" ; rdfs:subClassOf obo:CL_0000010, [ a owl:Class ; owl:complementOf [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600037 ] ], [ a owl:Class ; owl:complementOf [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom [ a owl:Class ; owl:intersectionOf (obo:CL_0000010 [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600037 ] ) ] ] ] . obo:CL_0000010 obo:IAO_0000111 "cultured cell" ; obo:IAO_0000115 "A cell in vitro that is or has been maintained or propagated as part of a cell culture." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "cultured cell" ; rdfs:subClassOf obo:CL_0000578, [ a owl:Class ; owl:unionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600036 ] [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600036 ] ] ) ] . obo:CL_0000236 obo:IAO_0000111 "B cell" ; obo:IAO_0000115 "A lymphocyte of B lineage that is capable of B cell mediated immunity." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "B cell" ; rdfs:subClassOf obo:CL_0000542 . obo:CL_0000542 obo:IAO_0000111 "lymphocyte" ; obo:IAO_0000115 "A lymphocyte is a leukocyte commonly found in the blood and lymph that has the characteristics of a large nucleus, a neutral staining cytoplasm, and prominent heterochromatin." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "lymphocyte" ; rdfs:subClassOf obo:CL_0000842 . obo:CL_0000578 obo:IAO_0000111 "experimentally modified cell in vitro" ; obo:IAO_0000115 "A cell in vitro that has undergone physical changes as a consequence of a deliberate and specific experimental procedure." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "experimentally modified cell in vitro" ; rdfs:subClassOf obo:CL_0000000, obo:OBI_0000047 . obo:CL_0000842 obo:IAO_0000111 "mononuclear cell" ; obo:IAO_0000115 "A leukocyte with a single non-segmented nucleus in the mature form." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "mononuclear cell" ; rdfs:subClassOf obo:CL_0000000 . obo:ENVO_01000254 obo:IAO_0000115 "A system which has the disposition to environ one or more material entities." ; obo:IAO_0000116 """1. Stub class to serve as root of hierarchy for imports from an ontology of environment and experimental conditions. 2. Need to consdier how to model environments in a way that covers ENVO and XCO content in a consistent and coherent way. A couple classes under Exploratory Class are relvant here. Consider how we might approach environments/condisitons using an EQ aproach analogous to how phenotypes are defined (i.e. consider environments/coonditions as qualities inhereing in some entity).""" ; oboInOwl:hasDbXref "EcoLexicon:environment" ; a owl:Class ; rdfs:comment "In ENVO's alignment with the Basic Formal Ontology, this class is being considered as a subclass of a proposed BFO class \"system\". The relation \"environed_by\" is also under development. Roughly, a system which includes a material entity (at least partially) within its site and causally influences that entity may be considered to environ it. Following the completion of this alignment, this class' definition and the definitions of its subclasses will be revised." ; rdfs:label "environmental system" ; rdfs:subClassOf obo:RO_0002577 . obo:ENVO_01001569 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1310", "https://www.worldwildlife.org/ecoregions/aa1310" ; a owl:NamedIndividual ; rdfs:label "Western Australian Mulga Shrublands Ecoregion"@en . obo:ENVO_01001571 oboInOwl:hasDbXref "https://www.worldwildlife.org/biomes/deserts-and-xeric-shrublands" ; a owl:NamedIndividual ; rdfs:label "Australasia Ecoregion"@en . obo:ENVO_01001572 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1309", "https://www.worldwildlife.org/ecoregions/aa1309" ; a owl:NamedIndividual ; rdfs:label "Tirari-Sturt Stony Desert Ecoregion" . obo:ENVO_01001573 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1308", "https://www.worldwildlife.org/ecoregions/aa1308" ; a owl:NamedIndividual ; rdfs:label "Simpson Desert Region"@en . obo:ENVO_01001574 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1307", "https://www.worldwildlife.org/ecoregions/aa1307" ; a owl:NamedIndividual ; rdfs:label "Pilbara Shrublands Ecoregion"@en . obo:ENVO_01001575 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1301", "https://www.worldwildlife.org/ecoregions/aa1301" ; a owl:NamedIndividual ; rdfs:label "Carnarvon Xeric Shrublands Ecoregion"@en . obo:ENVO_01001576 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1302", "https://www.worldwildlife.org/ecoregions/aa1302" ; a owl:NamedIndividual ; rdfs:label "Central Ranges Xeric Shrub Ecoregion"@en . obo:ENVO_01001577 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1303", "https://www.worldwildlife.org/ecoregions/aa1303" ; a owl:NamedIndividual ; rdfs:label "Gibson Desert Ecoregion"@en . obo:ENVO_01001578 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1304", "https://www.worldwildlife.org/ecoregions/aa1304" ; a owl:NamedIndividual ; rdfs:label "The Great Sandy-Tanami Desert Ecoregion"@en . obo:ENVO_01001579 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1305", "https://www.worldwildlife.org/ecoregions/aa1305" ; a owl:NamedIndividual ; rdfs:label "Great Victoria Desert Ecoregion"@en . obo:ENVO_01001580 obo:BFO_0000050 obo:ENVO_01001571 ; oboInOwl:hasDbXref "WWF:AA1306", "https://www.worldwildlife.org/ecoregions/aa1306" ; a owl:NamedIndividual ; rdfs:label "Nullarbor Plains Xeric Shrubland Ecoregion"@en . obo:ENVO_01001583 oboInOwl:hasDbXref "https://www.worldwildlife.org/biomes/deserts-and-xeric-shrublands" ; a owl:NamedIndividual ; rdfs:label "Afrotropical Ecoregion"@en . obo:ENVO_01001584 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1322", "https://www.worldwildlife.org/ecoregions/at1322" ; a owl:NamedIndividual ; rdfs:label "Succulent Karoo Ecoregion"@en . obo:ENVO_01001585 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1321", "https://www.worldwildlife.org/ecoregions/at1321" ; a owl:NamedIndividual ; rdfs:label "Yemen and Saudi Arabia Ecoregion"@en . obo:ENVO_01001586 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1320", "https://www.worldwildlife.org/ecoregions/at1320" ; a owl:NamedIndividual ; rdfs:label "Yemen, Saudi Arabia, and Oman Ecoregion"@en . obo:ENVO_01001587 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1319", "https://www.worldwildlife.org/ecoregions/at1319" ; a owl:NamedIndividual ; rdfs:label "Somali Montane Xeric Woodland Ecoregion"@en . obo:ENVO_01001588 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1318", "https://www.worldwildlife.org/ecoregions/at1318" ; a owl:NamedIndividual ; rdfs:label "Socotran Archipelago Ecoregion"@en . obo:ENVO_01001589 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1317", "https://www.worldwildlife.org/ecoregions/at1317" ; a owl:NamedIndividual ; rdfs:label "Red Sea Coastal Desert Ecoregion"@en . obo:ENVO_01001590 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1316", "https://www.worldwildlife.org/ecoregions/at1316" ; a owl:NamedIndividual ; rdfs:label "Namibian Savanna Woodland Ecoregion"@en . obo:ENVO_01001591 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1315", "https://www.worldwildlife.org/ecoregions/at1315" ; a owl:NamedIndividual ; rdfs:label "Namib Desert Ecoregion"@en . obo:ENVO_01001592 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1314", "https://www.worldwildlife.org/ecoregions/at1314" ; a owl:NamedIndividual ; rdfs:label "Nama Karoo Ecoregion"@en . obo:ENVO_01001593 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1313", "https://www.worldwildlife.org/ecoregions/at1313" ; a owl:NamedIndividual ; rdfs:label "Masai Xeric Grasslands and Shrublands Ecoregion"@en . obo:ENVO_01001594 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1312", "https://www.worldwildlife.org/ecoregions/at1312" ; a owl:NamedIndividual ; rdfs:label "Madagascar Succulent Woodlands Ecoregion"@en . obo:ENVO_01001595 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1311", "https://www.worldwildlife.org/ecoregions/at1311" ; a owl:NamedIndividual ; rdfs:label "Madagascar Spiny Thickets Ecoregion"@en . obo:ENVO_01001596 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1310", "https://www.worldwildlife.org/ecoregions/at1310" ; a owl:NamedIndividual ; rdfs:label "Kaokoveld Desert Ecoregion"@en . obo:ENVO_01001597 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1309", "https://www.worldwildlife.org/ecoregions/at1309" ; a owl:NamedIndividual ; rdfs:label "Kalahari Xeric Savanna Ecoregion"@en . obo:ENVO_01001598 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1308", "https://www.worldwildlife.org/ecoregions/at1308" ; a owl:NamedIndividual ; rdfs:label "Ile Europa and Bassas da India Ecoregion"@en . obo:ENVO_01001599 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1307", "https://www.worldwildlife.org/ecoregions/at1307" ; a owl:NamedIndividual ; rdfs:label "Hobyo Grassland and Shrubland Ecoregion"@en . obo:ENVO_01001600 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1306", "https://www.worldwildlife.org/ecoregions/at1306" ; a owl:NamedIndividual ; rdfs:label "Oman and United Arab Emirates Ecoregion"@en . obo:ENVO_01001601 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1305", "https://www.worldwildlife.org/ecoregions/at1305" ; a owl:NamedIndividual ; rdfs:label "Ethiopian Xeric Grasslands and Shrublands Ecoregion"@en . obo:ENVO_01001602 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1304", "https://www.worldwildlife.org/ecoregions/at1304" ; a owl:NamedIndividual ; rdfs:label "Eritrean Coastal Desert Ecoregion"@en . obo:ENVO_01001603 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1303", "https://www.worldwildlife.org/ecoregions/at1303" ; a owl:NamedIndividual ; rdfs:label "East Saharan Montane Xeric Woodland Ecoregion"@en . obo:ENVO_01001604 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1302", "https://www.worldwildlife.org/ecoregions/at1302" ; a owl:NamedIndividual ; rdfs:label "Oman, Yemen, and Saudi Arabia Ecoregion"@en . obo:ENVO_01001605 obo:BFO_0000050 obo:ENVO_01001583 ; oboInOwl:hasDbXref "WWF:AT1301", "https://www.worldwildlife.org/ecoregions/at1301" ; a owl:NamedIndividual ; rdfs:label "Aldabra Island Xeric Scrub Ecoregion"@en . obo:ENVO_01001626 oboInOwl:hasDbXref ; a owl:NamedIndividual ; rdfs:label "Indo-Malay Ecoregion"@en . obo:ENVO_01001627 obo:BFO_0000050 obo:ENVO_01001626 ; oboInOwl:hasDbXref , "WWF:IM1304" ; a owl:NamedIndividual ; rdfs:label "Thar Desert"@en . obo:ENVO_01001628 obo:BFO_0000050 obo:ENVO_01001626 ; oboInOwl:hasDbXref , "WWF:IM1303" ; a owl:NamedIndividual ; rdfs:label "Northwestern Thorn Scrub Forests"@en . obo:ENVO_01001862 obo:IAO_0000115 "Stellar radiation emitted from Sol." ; obo:RO_0002608 ; a owl:NamedIndividual ; rdfs:label "Solar radiation"@en . obo:GENO_0000000 obo:IAO_0000112 """Example zebrafish intrinsic genotype: Genotype = fgf8a; shha (AB) reference component (genomic background) = AB variant component ('genomic variation complement') = fgf8a; shha . . . and within this variant component, there are two 'variant single locus complements' represented: allele complement 1 = fgf8a allele complement 2 = shha and within each of these 'variant single locus complements' there is one or more variant gene locus member: in complement 1: fgf8a in complement 2: shha""" ; obo:IAO_0000115 "A genomic genotype that does not specify the sex determining chromosomal features of its bearer (i.e. does not indicate the background sex chromosome complement)" ; obo:IAO_0000116 """This modeling approach allows use to create separate genotype instances for data sources that report sex-specific phenotypes to ensure that sex-specific G2P differences are accurately described. These sex-qualified genotypes can be linked to the more general sex-agnostic intrinsic genotype that is shared by make and female mice of the same strain, to aggregate associated phenotypes at this level, and allow aggregation with G2P association data about the same strains from sources that distinguish sex-specific phenotypes (e.g. IMPC) and those that do not (e.g. MGI). Conceptually, a sex-qualified phenotype represents a superset of sequence features relative to a sex-agnostic intirnsic genotype, in that if specifies the background sex-chromosome complement of the genome. Thus, in the genotype partonomy, a sex-qualified genotype has as part a sex-agnostic genotype. This allows for the propagation of phenotypes associated with a sex-qualified genotype to the intrinsic genotype.""" ; obo:IAO_0000118 "genotype", "organismal genotype", "sex-agnostic intrinsic genotype" ; a owl:Class ; rdfs:comment "In practice, most genotype instances classified as sex-agnostic genotypes because they are not sex-specific. When a genotype is indicated to be that of a male or female, it implies a known sex chromosome complement in the genomic background. This requires us to distinguish separate 'sex-qualified' genotype instances for males and females that share a common 'sex-agnostic' genotype. For example, male and female mice that of the same strain/background and containing the same set of genetic variations will have the same sex-agnostic intrinsic genotype, but different sex-qualified intrinsic genotypes (which take into account background sex chromosome sequence as identifying criteria for genotype instances)." ; rdfs:label "genomic genotype (sex-agnostic)" ; rdfs:subClassOf obo:GENO_0000899 . obo:GENO_0000002 obo:IAO_0000115 "An allele that varies in it sequence from what is considered the reference or canonical sequence at that location." ; obo:IAO_0000116 "The use of the descriptor 'variant' here is consistent with naming recommendations from the ACMG Guidelines paper here: PMID:25741868. Generally, the descriptive labels chosen for subtypes of variant allele conform these recommendations as well, where 'variant' is used to cover mutant and polymorphic alleles." ; obo:IAO_0000118 "alternate allele", "sequence-variant feature", "variant feature" ; a owl:Class ; rdfs:comment """Note that what is considered the 'reference' vs. 'variant' sequence at a given locus may be context-dependent - so being 'variant' is more a role played in a particular situation. A 'variant allele' contains a 'sequence alteration', or is itself a 'sequence alteration', that makes it vary_with some other allele to which it is being compared. But in any comparison of alternative sequences at a particular genomic location, the choice of a 'reference' vs the 'variant' is context-dependent - as comparisons in other contexts might consider a different feature to be the reference. So being 'variant' is more a role played in a particular situation - as an allele that is variant in one context/analysis may be considered reference in another. A variant allele can be variant along its entire extent, in which case it is considered a 'sequence alteration', or it can span a broader extent of sequence contains sequence alteration(s) as part. And example of the former is a SNP, and an example of the latter is a variant gene allele that contains one or more point mutations in its sequence.""" ; rdfs:label "variant allele" ; rdfs:subClassOf obo:GENO_0000512, [ a owl:Class ; owl:unionOf (obo:SO_0001059 [ a owl:Restriction ; owl:onProperty obo:RO_0002524 ; owl:someValuesFrom obo:SO_0001059 ] ) ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000036 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000512 [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000036 ] ) ] . obo:GENO_0000009 obo:IAO_0000115 "A genomic feature set representing all 'variant single locus complements' in a single genome, which together constitute the 'variant' component of a genomic genotype." ; obo:IAO_0000116 "Note that even a reference feature (e.g. a wild-type gene) that is a member of a single locus complement that contains a variant allele is included in this 'genomic variation complement'. Thus, the members of this 'genomic variation complement' (which is a sequence collection) are 'single locus variant complements'. Our axiom below uses has_part rather than has_member, however, to account for the fact that many 'genomic variation complements' have only one 'single locus variant complement' as members. So because has_member is not reflexive, it is not appropriate for these cases." ; a owl:Class ; rdfs:comment """A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a complement may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features. Here, a 'genomic variation complement' is the set of all 'single locus complements' in a particular genome that harbor some known variation. In model organisms, the majority of genotypes describe variation at a single location in the genome (ie only one 'single-locus variant complement') that are variant realtive to some reference background. For example, the genotype instance 'fgf8a(AB)') exhibits a mutation at only one locus. But some genotypes describe variation at more than one location (e.g. a double mutant that has alterations in the fgf8a gene and the shh gene)).""" ; rdfs:label "genomic variation complement" ; rdfs:subClassOf obo:GENO_0000660, [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:GENO_0000030 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000660 [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:GENO_0000030 ] ) ] . obo:GENO_0000010 obo:IAO_0000112 "The ZFIN background 'AB' that serves as a reference as part of the genotype fgf8a^ti282a/+ (AB)" ; obo:IAO_0000115 "A reference genome that represents the sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations)." ; obo:IAO_0000116 "Here, a 'genomic background' would differ form a 'reference genome' in that 'background' implies a derivation of the variant from the background (which is the case for most MOD strains), whereas a reference is simply meant as a target for comparison. But in a sense all background genomes are by default reference, in that the derived variant genome is compared against it." ; obo:IAO_0000118 "genomic background" ; oboInOwl:hasDbXref "OBI:genetic population background information" ; a owl:Class ; rdfs:label "background genome" ; rdfs:subClassOf obo:GENO_0000914 . obo:GENO_0000014 obo:IAO_0000112 """The reference/wild-type cd99l2 danio rerio gene allele spans bases 27,004,426-27,021,059 on Chromosome 7. The \"mn004Gt\" represents an experimentally-created allele of this gene, in which sequence from a gene trap construct containing an RFP marker has been inserted at the cd99l2 gene locus. The resulting gene allele includes sequence from this construct that make it longer than the reference gene sequence, and also alter its seqauence in a way that prevents it from producing a functional product. The sequence extent of this cd99l2 gene allele is determined based on how its sequence aligns with that of the canonical gene and surrounding sequence in a reference genome. http://useast.ensembl.org/Danio_rerio/Gene/Summary?g=ENSDARG00000056722 http://zfin.org/action/feature/feature-detail?zdbID=ZDB-ALT-111117-8""" ; obo:IAO_0000115 "A genomic feature that represents one of a set of versions of a gene (i.e. a haplotype whose extent is that of a gene)" ; obo:IAO_0000116 """Regarding the distinction between a 'gene' and a 'gene allele': Every zebrafish genome contains a 'gene allele' for every zebrafish gene. Many will be 'wild-type' or at least functional gene alleles. But some may be alleles that are mutated or truncated so as to lack functionality. According to current SO criteria defining genes, a 'gene' no longer exists in the case of a non-functional or deleted variant. But the 'gene allele' does exist - and its extent is that of the remaining/altered sequence based on alignment with a reference gene. Even for completely deleted genes, an allele of the gene exists (and here is equivalent to the junction corresponding to the where gene would live based on a reference alignment). This design allows us to classify genes and any variants of those genes (be they functional or not) as the same type of thing (ie a 'gene allele'), since classification is based on genomic position rather than functional capacity. This is practical for representation of variant genotypes which often carry non-functional versions of a gene at a particular locus. What is important here is specifying what is present at a locus associated with a particular gene, whether or not it is a functional gene or not.""" ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/SO_0001023 ! allele" ; a owl:Class ; rdfs:comment """In SO, the concept of a 'gene' is functionally defined, in that a gene necessarily produces a functional product. By contrast, the concept of a 'gene allele' here is positionally defined - representing the sequence present at the location a gene resides in a reference genome (based on sequence alignment). An Shh gene allele, for example, may be a fully functional wild-type version of the gene, a non-functional version carrying a deleterious point mutation, a truncated version of the gene, or even a complete deletion. In all these cases, an 'Shh gene allele' exists at the position where the canonical gene resides in the reference genome - even if the extent of this allele different than the wild-type, or even zero in the case of the complete deletion. A genomic feature being an allele_of a gene is based on its location in a host genome - not on its sequence. This means, for example, that the insertion of the human SMN2 gene into the genome of a mouse (see http://www.informatics.jax.org/allele/MGI:3056903) DOES NOT represent an allele_of the human SMN2 gene according to the GENO model - because it is located in a mouse genome, not a human one. Rather, this is a transgenic insertion that derives_sequence_from the human SMN2 gene. If this human SMN2 gene is inserted within the mouse SMN2 gene locus (e.g. used to replace mouse SMN2 gene), the feature it creates is an allele_of the mouse SMN2 gene (one that happens to match the sequence of the human ortholog of the gene). But again, it is not an allele_of the human SMN2 gene.""" ; rdfs:label "gene allele" ; rdfs:subClassOf obo:GENO_0000512, [ a owl:Restriction ; owl:onProperty obo:GENO_0000408 ; owl:someValuesFrom obo:SO_0000704 ] . obo:GENO_0000017 obo:IAO_0000115 "A sequence that serves as a standard against which other sequences at the same location are compared." ; obo:IAO_0000116 "The notion of a 'reference' in GENO is implemented at the level of 'biological sequence' rather than at the level of a sequence feature - i.e. we define a class for 'reference sequence' rather than reference sequence feature'. This is because it is at the *sequence* level that features of interest are determined to be variant or not. It is taken for granted that the *location* of the feature of interest is the same as that of the reference sequence to which it is compared, becasue an alignment process establishing common location always precedes the sequence comparison that determines if the feature is variant." ; obo:IAO_0000118 "reference sequence" ; a owl:Class ; rdfs:comment "A reference sequence is one that serves as a standard against which 'variant' versions of the feature are compared, or against which located sequence features within the reference region are aligned in order to assign position information. Being 'reference' does not imply anything about the frequency or function of features bearing the sequence. Only that some agent has used it to serve a reference role in defining a variant or locating a sequence." ; rdfs:label "reference sequence" ; rdfs:subClassOf obo:GENO_0000702, [ a owl:Restriction ; owl:onProperty obo:GENO_0000968 ; owl:someValuesFrom obo:GENO_0000152 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000702 [ a owl:Restriction ; owl:onProperty obo:GENO_0000968 ; owl:someValuesFrom obo:GENO_0000152 ] ) ] . obo:GENO_0000019 obo:IAO_0000115 "a collection more than one sequence features (ie a collection of discontinuous sequence features)" ; oboInOwl:hasDbXref "perhaps not same as SO:sequence collection, as here we explicitly include features that can have an extent of zero (and SO:sequence collection is a collection of regions that have an extent of at least one)" ; a owl:Class ; rdfs:comment "1. Note that members of this class can be features with extents of zero (e.g. junctions). This is likely different than the SO:sequence feature class which has members that are regions." ; rdfs:label "obsolete sequence feature collection" ; owl:deprecated true . obo:GENO_0000022 obo:IAO_0000115 "A sequence feature collection comprised of discontiguous sequences from a single genome" ; obo:IAO_0000116 "Previously called 'genetic locus collection'. Difference between 'genetic' and 'genomic', as used here, is that 'genomic' implies a feature is a heritable part of some genome, while 'genetic' implies that it is part of some feature that is capable of contributing to gene expression in a cell or other biological system." ; obo:IAO_0000118 "genomic feature collection" ; a owl:Class ; rdfs:comment "Conceptually, members of this collection are meant to be about the sum total genetic material in a single cell or organism. But these members need not be associated with an actual material in a real cell or organism individual. For example, things like a 'reference genome' may not actually represent the material genome of any individual cell or organism in reality. Here, there may be no genomic material referents of the sequences in such a collection because the genome is tied to an idealized, hypothetical cell or organism instance. The key is that conceptually, they are still tied to the idea of being contained in a single genome. In the case of a genotype, the individual seqeunce members are not all about the genetic material of a singel cell or organism. Rather, it is the resolved sequence contained in the genotype that is meant to be about the total genomic sequence content of a genome - which we deem acceptable for classifying as a genetic locus collection." ; rdfs:label "obsolete genomic feature collection" ; owl:deprecated true . obo:GENO_0000029 obo:IAO_0000115 "A single locus complement that serves as a standard against which 'variant' sequences are compared" ; obo:IAO_0000118 "reference allelic complement", "reference single locus feature complement" ; obo:IAO_0000231 """Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity. Eq Class axiom: 'single locus complement' and (has_sequence_attribute some reference) SC axioms: 'has member' exactly 0 'variant allele' 'has member' only 'reference genomic feature' 'has member' some 'reference genomic feature'""" ; a owl:Class ; rdfs:label "obsolete reference single locus complement" ; owl:deprecated true . obo:GENO_0000030 obo:IAO_0000115 "A single locus complement in which at least one member allele is considered variant, and/or the total number of features in the complement deviates from the normal poloidy of the reference genome (e.g. trisomy 13)." ; obo:IAO_0000118 "variant allelic complement"@en ; a owl:Class ; rdfs:comment """Instances of this class are sets comprised of all allels at a specified genomic location where at least one allele is variant (non-reference). In diploid genomes this complement typically has two members. Note that this class also covers cases where deviant numbers of genes or chromosomes are present in a genome (e.g. trisomy of chromosome 21), even if their sequence is not variant.""" ; rdfs:label "variant single locus complement" ; rdfs:subClassOf obo:GENO_0000516, [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:GENO_0000002 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000516 [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:GENO_0000002 ] ) ] . obo:GENO_0000033 obo:IAO_0000115 "A genome that varies at one or more loci from the sequence of some reference genome." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/SO_0001506 ! variant_genome (definition of SO term here is too vague to know if has same meaning as GENO class here)" ; a owl:Class ; rdfs:label "variant genome" ; rdfs:subClassOf obo:SO_0001026, [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:SO_0001059 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000914 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0001026 [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000914 ] ) ] . obo:GENO_0000036 obo:IAO_0000115 "An allele whose sequence matches what is consdiered to be the reference sequence at that location in the genome." ; a owl:Class ; rdfs:comment """Being a 'reference allele' is a role or status assigned in the context of a specific dataset or analysis. In human variation datasets, 'reference' status is typically assigned based on factors such as being the most common in a population, being an ancestral allele, or being indentified first as a prototypical example of some feature or gene. For example, 'reference alleles' in characterizing SNPs often represent the allele first characterized in a reference genome, or the most common allele in a population. In model organism datasets, 'reference' alleles are typically (but not always) the 'wild-type' variant at a given locus, representing a functional and unaltered version of the feature that is part of a defined genomic background, and against which natural or experimentally-induced alterations are compared.""" ; rdfs:label "reference allele" ; rdfs:subClassOf obo:GENO_0000512, [ a owl:Restriction ; owl:onProperty obo:GENO_0000968 ; owl:someValuesFrom obo:GENO_0000152 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000512 [ a owl:Restriction ; owl:onProperty obo:GENO_0000968 ; owl:someValuesFrom obo:GENO_0000152 ] ) ] . obo:GENO_0000037 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A genomic feature known to exist, but remaining uncharacterized with respect to its identity (e.g. which allele exists at a given gene locus)." ; obo:IAO_0000116 "Uses as a term of convenience for describing data reporting unspecified alleles in a genotype (i.e. in cases where zygosoty for a given locus is not known). Typlically recorded in genotype syntaxes as a ' /? '." ; obo:IAO_0000231 """Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity. Eq Class def: 'genomic feature' and (has_sequence_attribute some unspecified)""" ; a owl:Class ; rdfs:comment "An unspecified feature is known to exist as the partner of a characterized allele when the zygosity at that locus is not known. Its specific sequence/identity, however, is unknown (ie whether it is a reference or variant allele)." ; rdfs:label "obsolete unspecified feature" ; owl:deprecated true . obo:GENO_0000042 obo:IAO_0000115 "A junction found at a chromosomal position where an insertion has occurred on the homologous chromosome, such that the junction represents the reference feature paired with the hemizygously inserted feature." ; obo:IAO_0000118 "hemizygous reference junction" ; obo:IAO_0000231 """Eliminating unecessary defined/organizational classes. Former logical def: junction and (has_sequence_attribute some reference) Subclass axiom: is_variant_with some insertion""" ; a owl:Class ; rdfs:comment """In the case of a transgenic insertion that creates a hemizygous locus, the refernce locus that this insertion is variant_with is the junction on the homologous chromosome at the same position where the insertion occurred. This is the 'hemizygous reference' junction. The junction-insertion pair represents the allelic complement at that locus, which is considered to be hemizygous. Most genotype syntaxes represent this hemizygous state with a ' /0' notation.""" ; rdfs:label "obsolete reference junction" ; owl:deprecated true . obo:GENO_0000047 obo:IAO_0000115 "A gene that originates from the genome of a danio rerio." ; a owl:Class ; rdfs:label "danio rerio gene" ; rdfs:subClassOf obo:SO_0000704, [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:NCBITaxon_7955 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0000704 [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:NCBITaxon_7955 ] ) ] . obo:GENO_0000054 obo:IAO_0000115 "A gene that originates from the genome of a homo sapiens." ; a owl:Class ; rdfs:label "homo sapiens gene" ; rdfs:subClassOf obo:SO_0000704, [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:NCBITaxon_9606 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0000704 [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:NCBITaxon_9606 ] ) ] . obo:GENO_0000057 obo:IAO_0000115 "A gene that originates from the genome of a mus musculus." ; a owl:Class ; rdfs:label "mus musculus gene" ; rdfs:subClassOf obo:SO_0000704, [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:NCBITaxon_10090 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0000704 [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:NCBITaxon_10090 ] ) ] . obo:GENO_0000060 obo:IAO_0000112 """A reference human sonic hedgehog (shh) gene spans bases 155,592,680-155,604,967 on Chromosome 7, according to genome build GRCh37, and produces a primary funcitonal transcript that is 4454 bp in length and produces a 462 amino acid protein involved in cell signaling events behind various aspects of cell differentiation and development. http://useast.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000164690 Note that this may be slightly different than the extend described in other gene databases, such as Entrez Gene:http://www.ncbi.nlm.nih.gov/gene/6469""" ; obo:IAO_0000115 "A version/allele of a gene that serves as a standard against which variant genes are compared." ; obo:IAO_0000118 "reference gene" ; obo:IAO_0000231 """Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity. Eq Class axiom: 'gene allele' and (has_sequence_attribute some reference) SC axioms: is_variant_with some 'gene allele' is_reference_allele_of some gene""" ; a owl:Class ; rdfs:comment """Being a 'reference gene' is a role or status assigned in the context of a specific dataset or analysis. In human variation datasets, 'reference' status is typically assigned based on factors such as being the most common version/allele in a population, being an ancestral allele, or being indentified first as a prototypical example of a gene. In model organism datasets, 'reference' genes are typically the 'wild-type' allele for a given gene, representing a functional and unaltered version of the gene that is part of a defined genomic background, and against which natural or experimentally-induced versions are compared.""" ; rdfs:label "obsolete reference gene allele" ; owl:deprecated true . obo:GENO_0000091 a owl:Class ; rdfs:label "obsolete experimental insertion" ; owl:deprecated true . obo:GENO_0000092 a owl:Class ; rdfs:label "gene trap insertion" ; rdfs:subClassOf obo:SO_0000667 . obo:GENO_0000093 obo:IAO_0000115 "A transgene that has been integrated into a chrromosome in the host genome." ; a owl:Class ; rdfs:comment """An integrated transgene differs from a transgenic insertion in that a transgenic insertion may contain single transgene, a partial transgene that needs endognous sequences from the host genome to become functional (e.g. an enhancer trap), or multiple transgenes (i.e. be polycistronic). Fiurthermore, the transgenic insertion may contain sequences in addition to its transgene(s - e.g. sequences flanking the transgene reqired for integration or replicaiton/maintenance in the host genome. The term 'integrated transgene' covers individual transgenes that were delivered in whole or in part by a transgenic insertion. An 'integrated transgene' differs from its parent 'transgene' in that transgenes can include genes introduced into a cell/organism on an extra-chromosomal plasmid that is never integrated into the host genome.""" ; rdfs:label "integrated transgene" ; rdfs:subClassOf obo:SO_0000902, [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:SO_0001218 ] . obo:GENO_0000106 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A nucleic acid macromolecule that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or is capable of being replicated and inherited through successive generations of progeny." ; obo:IAO_0000116 """1. Note that at present, a material genome and genetic material are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genomic material - rather, we could say that this genomic library is a 'genomic material sample' that bears the concretization of some genome. 2. A challenging edge case is experimentally delivered DNA into a terminally differentiated cell that will never divide. Such material does technically meet our definition - since we are careful to say that the material must be *capable of* being stably inherited through subsequent generations. Thus, we would say that *if* the cell were resume replication, the material would be heritable in this way.""" ; a owl:Class ; rdfs:comment """1. Genomic material here is considered as a DNA or RNA molecule that is found in a cell or virus, and capable of being replicated and inherited by progeny cells or virus. As such, this nucleic acid is either chromosomal DNA, or some replicative epi-chromosomal plasmid or transposon. Genetic material is necessarily part of some 'material genome', and both are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genetic material - rather, we could say that this genomic library is a 'genomic material sample' that bears the concretization of some genome. 2. Genomic material need not be inherited from an immediate ancestor cell or organism (e.g. a replicative plasmid or transposon acquired through some experimental modification), but such cases must be capable of being inherited by progeny cells or organisms.""" ; rdfs:label "genomic material" ; rdfs:subClassOf obo:GENO_0000482, [ a owl:Restriction ; owl:onProperty obo:RO_0000091 ; owl:someValuesFrom obo:GENO_0000139 ] . obo:GENO_0000108 obo:IAO_0000115 "A material entity that represents all genetic material in a cell or virion. The material genome is typically molecular aggregate of all the chromosomal DNA and epi-chromosomal DNA that represents all sequences that are heritable by progeny of a cell or virion." ; obo:IAO_0000118 "physical genome" ; a owl:Class ; rdfs:comment """A genome is the collection of all nucleic acids in a cell or virus, representing all of an organism's hereditary information. It is typically DNA, but many viruses have RNA genomes. The genome includes both nuclear chromosomes (ie nuclear and micronucleus chromosomes) and cytoplasmic chromosomes stored in various organelles (e.g. mitochondrial or chloroplast chromosomes), and can in addition contain non-chromosomal elements such as replicative viruses, plasmids, and transposable elements. Note that at present, a material genome and genetic material are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genetic material - rather, we could say that this genomic library is a 'genomic material sample' that bears the concretization of some SO:genome.""" ; rdfs:label "material genome" ; rdfs:subClassOf obo:BFO_0000040 . obo:GENO_0000111 obo:IAO_0000115 "a population of homo sapiens grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role)" ; obo:IAO_0000116 "Consider http://semanticscience.org/resource/SIO_001062 ! human population (\"A human population refers to a collection of human beings\")." ; obo:IAO_0000118 "homo sapiens population" ; a owl:Class ; rdfs:label "human population" ; rdfs:subClassOf obo:OBI_0000181 . obo:GENO_0000112 obo:IAO_0000115 "A maximal collection of organisms of a single species that have been bred or experimentally manipulated with the goal of being genetically identical." ; obo:IAO_0000118 "organism strain or breed" ; a owl:Class ; rdfs:comment "Two mice colonies with the same genotype information, but maintained in different labs, are different strains (many examples of this in MGI/IMSR)" ; rdfs:label "strain or breed" ; rdfs:subClassOf obo:GENO_0000113, [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:OBI_0100026 ] . obo:GENO_0000113 obo:IAO_0000116 "A group comprised of organisms from a single taxonomic group (e.g. family, order, genus, species, or a strain or breed within a given taxon)" ; a owl:Class ; rdfs:label "taxonomic group" ; rdfs:subClassOf obo:PCO_0000000 . obo:GENO_0000118 a owl:Class ; rdfs:label "mus musculus strain" ; rdfs:subClassOf obo:GENO_0000112 . obo:GENO_0000119 a owl:Class ; rdfs:label "danio rerio strain" ; rdfs:subClassOf obo:GENO_0000112, [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:NCBITaxon_7955 ], [ a owl:Restriction ; owl:allValuesFrom obo:NCBITaxon_7955 ; owl:onProperty obo:RO_0002351 ] . obo:GENO_0000125 obo:IAO_0000115 "sequence attribute that can inhere only in a collection of more than one sequence features" ; a owl:Class ; rdfs:label "obsolete sequence feature collection attribute" ; owl:deprecated true . obo:GENO_0000131 obo:IAO_0000115 "A quality inhering in a collection of discontinuous sequence features in a single genome that reside on the same macromolecule (eg the same chromosomes)." ; a owl:Class ; rdfs:label "in cis" ; rdfs:subClassOf obo:GENO_0000886 . obo:GENO_0000132 obo:IAO_0000115 "A quality inhering in a collection of discontinuous sequence features in a single genome that reside on different macromolecules (e.g. different chromosomes)." ; a owl:Class ; rdfs:label "in trans" ; rdfs:subClassOf obo:GENO_0000886 . obo:GENO_0000133 obo:IAO_0000115 "An allelic state that describes the degree of similarity between features in a 'single locus complement', within the genome of a cell or organism (i.e., whether the alleles or haplotypes that reside at the same location on paired chromosomes are the same or different)." ; obo:IAO_0000118 "allelic state" ; obo:IAO_0000119 "derived from https://en.wikipedia.org/wiki/Zygosity" ; oboInOwl:hasDbXref "http://semanticscience.org/resource/SIO_001263" ; a owl:Class ; rdfs:label "zygosity" ; rdfs:subClassOf obo:GENO_0000875, [ a owl:Restriction ; owl:onProperty obo:RO_0000052 ; owl:someValuesFrom obo:GENO_0000516 ] . obo:GENO_0000134 obo:IAO_0000115 "A zygosity quality inhering in a 'single locus complement' with half the number of alleles than normal (e.g. a single allele in a diploid genome, for example, a locus on the Y chromosome in a eukaryotic male genome, or a transgene that is present only in one of the two parental chromosome sets)" ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "hemizygous" ; rdfs:subClassOf obo:GENO_0000391 . obo:GENO_0000135 obo:IAO_0000115 "A zygosity quality inhering in a 'single locus complement' where the copies of the feature at this location have at least one difference in sequence (in a eukaryotic diploid genome, this means having two distinct alleles on each of the two homologous chromosomes, one inherited from each parent)." ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "heterozygous" ; rdfs:subClassOf obo:GENO_0000391 . obo:GENO_0000136 obo:IAO_0000115 "A zygosity quality inhering in a 'single locus complement' where all copies of the feature at this location have the same sequence (in a eukaryotic diploid genome, this means having identical alleles on each of the two homologous chromosomes, one inherited from each parent)." ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "homozygous" ; rdfs:subClassOf obo:GENO_0000391 . obo:GENO_0000137 obo:IAO_0000118 "indeterminite zygosity", "no-call zygosity", "unknown zygosity" ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "unspecified zygosity" ; rdfs:subClassOf obo:GENO_0000133 . obo:GENO_0000138 obo:IAO_0000115 "The disposition of an entity to be transmitted to subsequent generations following a genetic replication or organismal reproduction event." ; a owl:Class ; rdfs:comment """We can use these terms to describe the heritability of genetic matieral or sequence features - e.g. chromosomal DNA or genes are heritable in that they are passed on to child cells/organisms). Such genetic material has a heritable disposition in a cell or virion, in virtue of its being replicated in its cellular host and inherited by progeny cells (such that the sequence content it encodes is stably propagated in the genetic material of subsequence generations of cells). We can also use these terms to describe the heritability of phenotypes/conditions - e.g. the passage of a particular trait or disease across generations of reproducing cells/organisms.""" ; rdfs:label "heritabililty" ; rdfs:subClassOf obo:BFO_0000016 . obo:GENO_0000139 a owl:Class ; rdfs:label "heritable" ; rdfs:subClassOf obo:GENO_0000138 . obo:GENO_0000140 a owl:Class ; rdfs:label "non-heritable" ; rdfs:subClassOf obo:GENO_0000138 . obo:GENO_0000141 obo:IAO_0000115 "The pattern in which a genetic trait or condition is passed from one generation to the next, as determined by genetic interactions between alleles of the causal gene, and interactions between these alleles and the environment." ; obo:IAO_0000116 "The subtypes of inheritance pattern in this hierarchy are largely distinguished based on the underlying genetic mechanism, which will manifest in a characteristic pattern of traits in affected and unaffected family members. For example, 'autosomal dominant inheritance' defines an inheritance pattern that is caused by the interaction of alleles on non-sex chromosomes wherein the trait manifests even in heterozygotes - resulting in a characteristic pattern of 'dominant' inheritance across generations of individuals in a family." ; obo:IAO_0000118 "mode of inheritance", "phenotypic inheritance pattern" ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0000005", "http://purl.obolibrary.org/obo/NCIT_C45827" ; a owl:Class ; rdfs:comment """An inheritance pattern results from the disposition of a genetic variant to cause a particular trait or phenotype when it is present in a particular genetic and environmental context. Here, \"genetic context\" refers to the allelic state of the variant, which depends on what other alleles exist at the same location/locus in the genome. Zygosities such as heterozygous and homozygous are simple, common examples of 'states' of an allele. These genetic and environmental \"interactions\" of alleles play out at the level of the gene products produced by the causal alleles, and are observable in the pattern with which the trait caused by an allele is inherited across generations of individuals. Thus, an inheritance pattern such as dominance is not inherent to a single allele or its phenotype, but rather a result of the relationship between two alleles of a gene and the phenotype that results in a given environment. This also means that the 'dominance' of an allele is context dependent - Allele 1 can be dominant over Allele 2 in the context of Phenotype X, but recessive to Allele 3 in the context of Phenotype Y.""" ; rdfs:label "inheritance pattern" ; rdfs:subClassOf obo:BFO_0000016 . obo:GENO_0000142 obo:IAO_0000115 "disposition inhering in a genetic locus variant that is realized in its inheritance by some offspring such that at least a partial variant-associated phenotype is apparent in heterozygotes" ; obo:IAO_0000231 "Triage until decide if want to define this as grouping class that would result in multiple-inheritance." ; a owl:Class ; rdfs:label "obsolete dominant inheritance" ; owl:deprecated true . obo:GENO_0000143 obo:IAO_0000115 "An autosomal dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." ; a owl:Class ; rdfs:label "co-dominant autosomal inheritance" ; rdfs:subClassOf obo:GENO_0000147 . obo:GENO_0000144 obo:IAO_0000115 "An autosomal dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." ; obo:IAO_0000118 "pure dominant inheritance" ; a owl:Class ; rdfs:label "complete autosomal dominant inheritance" ; rdfs:subClassOf obo:GENO_0000147 . obo:GENO_0000145 obo:IAO_0000115 "An autosomal dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." ; obo:IAO_0000118 "intermediate dominant autosomal inheritance", "semi-dominant autosomal inheritance" ; a owl:Class ; rdfs:label "incomplete autosomal dominant inheritance" ; rdfs:subClassOf obo:GENO_0000147 . obo:GENO_0000146 obo:IAO_0000115 "An X-linked inheritance pattern wherein the trait manifests in heterozygotes." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0001423" ; a owl:Class ; rdfs:label "X-linked dominant inheritance" ; rdfs:subClassOf obo:GENO_0000936 . obo:GENO_0000147 obo:IAO_0000115 "An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in heterozygotes." ; obo:IAO_0000118 "vertical inheritance" ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0000006" ; a owl:Class ; rdfs:label "autosomal dominant inheritance" ; rdfs:subClassOf obo:GENO_0000934 . obo:GENO_0000148 obo:IAO_0000115 "An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in homozygous but not heterozygote individuals." ; a owl:Class ; rdfs:label "autosomal recessive inheritance" ; rdfs:subClassOf obo:GENO_0000934 . obo:GENO_0000149 obo:IAO_0000115 "An X-linked inheritance pattern wherein a trait caused by alleles of a gene on the X-chromosome manifests in homozygous but not heterozygote individuals." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0001419" ; a owl:Class ; rdfs:label "X-linked recessive inheritance"@en ; rdfs:subClassOf obo:GENO_0000936 . obo:GENO_0000150 obo:IAO_0000231 "duplicate term, use GENO:0000148" ; a owl:Class ; rdfs:label "obsolete autosomal recessive inheritance" ; owl:deprecated true . obo:GENO_0000152 obo:IAO_0000115 "An attribute inhering in a feature that is designated to serve as a standard against which 'variant' versions of the same location are compared." ; a owl:Class ; rdfs:comment "Being 'reference' is a role or status assigned in the context of a data set or analysis framework. A given allele can be reference on one context and variant in another." ; rdfs:label "reference" ; rdfs:subClassOf obo:GENO_0000773 . obo:GENO_0000160 a owl:Class ; rdfs:label "unspecified life cycle stage" ; rdfs:subClassOf obo:UBERON_0000105 . obo:GENO_0000164 a owl:Class ; rdfs:label "obsolete genetic insertion technique" ; owl:deprecated true . obo:GENO_0000165 a owl:Class ; rdfs:label "obsolete mutagen treatment technique" ; owl:deprecated true . obo:GENO_0000166 a owl:Class ; rdfs:label "obsolete targeted gene mutation technique" ; owl:deprecated true . obo:GENO_0000169 a owl:Class ; rdfs:label "obsolete random genetic insertion technique" ; owl:deprecated true . obo:GENO_0000170 a owl:Class ; rdfs:label "obsolete targeted genetic insertion technique" ; owl:deprecated true . obo:GENO_0000171 a owl:Class ; rdfs:label "obsolete enhancer trapping technique" ; owl:deprecated true . obo:GENO_0000172 a owl:Class ; rdfs:label "obsolete gene trapping technique" ; owl:deprecated true . obo:GENO_0000173 a owl:Class ; rdfs:label "obsolete promoter trapping technique" ; owl:deprecated true . obo:GENO_0000174 a owl:Class ; rdfs:label "obsolete targeted knock-in technique" ; owl:deprecated true . obo:GENO_0000175 a owl:Class ; rdfs:label "obsolete random transgene insertion technique" ; owl:deprecated true . obo:GENO_0000207 obo:IAO_0000115 "A relation used to link sequence entities (sequences, features, qualified features, and collections thereof) to their 'attributes'." ; obo:IAO_0000116 "Used in lieu of RO/BFO has_quality as this relation is definend to apply to independent contiinuant bearers, wheras sequence entities are generically dependent continuants." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/so_has_quality" ; a owl:ObjectProperty ; rdfs:domain [ a owl:Class ; owl:unionOf (obo:GENO_0000701 obo:GENO_0000702 obo:GENO_0000713 ) ] ; rdfs:label "has_sequence_attribute" ; rdfs:subPropertyOf owl:topObjectProperty . obo:GENO_0000211 obo:IAO_0000115 "A relation between a material information bearer or material genetic sequence bearer and generically dependent continuant that carries information or sequence content that the bearer encodes" ; obo:IAO_0000118 "materializes" ; a owl:ObjectProperty ; rdfs:comment "Shortcut relation expanding to bearer_of some (concretizes some . . . ), linking a material information bearer or sequence macromolecule to some ICE or GDC sequence." ; rdfs:label "bears_concretization_of" ; owl:propertyChainAxiom (obo:RO_0000053 obo:RO_0000059 ) . obo:GENO_0000220 a owl:ObjectProperty ; rdfs:label "is_genotype_of" ; owl:inverseOf obo:GENO_0000222 . obo:GENO_0000222 obo:IAO_0000115 "A relationship that holds between a biological entity and some level of genetic variation present in its genome." ; obo:IAO_0000116 "This relation aims to be equally as broad/inclusive as RO:0002200 ! has_phenotype." ; a owl:ObjectProperty ; rdfs:comment "The biological entity can be an organism, a group of organism that share common genotype, or organism-derived entities such as cell lines or biospecimens. The genotype can be any of the various flavors of genotypes/allelotypes defined in GENO (intrinsic genotype, extrinsic genotype, effective genotype), or any genetic variation component of a genotype including variant alleles or sequence alterations." ; rdfs:domain [ a owl:Class ; owl:unionOf (obo:GENO_0000536 [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:GENO_0000536 ] ) ] ; rdfs:label "has_genotype" . obo:GENO_0000231 obo:IAO_0000115 "An antisymmetric, irreflexive (normally transitive) relation between a whole and a distinct part (source: SIO)" ; obo:IAO_0000116 "No proper part relation anymore in RO/BFO?" ; oboInOwl:hasDbXref "http://semanticscience.org/resource/SIO_000053" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "has_proper_part" ; rdfs:subPropertyOf obo:BFO_0000051 ; owl:inverseOf obo:GENO_0000248 . obo:GENO_0000239 obo:IAO_0000115 "A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears." ; obo:IAO_0000118 "has_sequence_component", "has_state" ; oboInOwl:hasDbXref "VMC:state" ; a owl:ObjectProperty ; rdfs:comment "'Sequence' in the context of GENO is an abstract entity representing an ordered collection of monomeric units as carried in a biological macromolecule." ; rdfs:label "has_sequence" ; rdfs:range obo:GENO_0000702 ; owl:inverseOf obo:GENO_0000251 . obo:GENO_0000242 obo:IAO_0000112 """A geno:intrinnsic genotype 'specifies' a SO:genome. A geno:karyotype 'specifies' a geno:karyotype feature collection.""" ; obo:IAO_0000115 "A relationship between an information content entity representing a specification, and the entity it specifies." ; a owl:ObjectProperty ; rdfs:label "obsolete_specifies" ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000243 obo:IAO_0000116 "Created subproperties 'approximates_sequence' and 'resolves to sequence'. Genotypes and other sequence variant artifacts are not always expected to completely specify a sequence, but rather provide some approximation based on available knowledge. The 'resolves_to_sequence' property can be used when the sequence variant artifact is able to completely resolve a sequence, and the 'approximates_sequence' property can be used when it does not. " ; a owl:ObjectProperty ; rdfs:label "obsolete_approximates_sequence" ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000244 obo:IAO_0000116 "Created subproperties 'approximates_sequence' and 'resolves to sequence'. Genotypes and other sequence variant artifacts are not always expected to completely specify a sequence, but rather provide some approximation based on available knowledge. The 'resolves_to_sequence' property can be used when the sequence variant artifact is able to completely resolve a sequence, and the 'approximates_sequence' property can be used when it does not. " ; a owl:ObjectProperty ; rdfs:label "obsolete_resolves_to_sequence" ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000248 obo:IAO_0000115 "An asymmetric, irreflexive (normally transitive) relation between a part and its distinct whole." ; oboInOwl:hasDbXref "http://semanticscience.org/resource/SIO_000093" ; a owl:ObjectProperty ; rdfs:label "is_proper_part_of" ; rdfs:subPropertyOf obo:BFO_0000050 . obo:GENO_0000251 a owl:ObjectProperty ; rdfs:domain obo:GENO_0000702 ; rdfs:label "is_sequence_of" . obo:GENO_0000252 a owl:ObjectProperty ; rdfs:label "is_subject_of" ; owl:inverseOf obo:IAO_0000136 . obo:GENO_0000253 a owl:ObjectProperty ; rdfs:label "obsolete_is_specified_by" ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000324 obo:IAO_0000115 "A single locus complement that represents the collection of all chromosome sequences for a given chromosome in a single genome" ; a owl:Class ; rdfs:label "obsolete chromosome complement" ; owl:deprecated true . obo:GENO_0000338 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A complete chromosome that has been abnormally duplicated in a genome, typically as the result of a meiotic non-disjunction event or unbalanced translocation" ; obo:IAO_0000118 "duplicate chromosome" ; a owl:Class ; rdfs:comment "This 'gained' chromosome is conceptually an 'insertion' in a genome that received two copies of a chromosome in a cell division following a non-disjunction event. As such, it qualifies as a type of sequence_alteration, and as a 'extra' chromosome." ; rdfs:label "gained aneusomic chromosome" ; rdfs:subClassOf obo:GENO_0000346, [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000685 ] . obo:GENO_0000339 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A 'deletion' resulting from the loss of a complete chromosome, typically as the result of a meiotic non-disjunction event or unbalanced translocation." ; obo:IAO_0000116 "This 'lost' chromosome is conceptually a 'deletion' in a genome that received zero copies of a chromosome in a cell division following a non-disjunction event. As such, it qualifies as a type of sequence_alteration. But it doesn't classify under SO:deletion because this class is defined as \"the point at which one or more contiguous nucleotides were excised\"." ; obo:IAO_0000118 "absent aneusomic chromosome" ; a owl:Class ; rdfs:label "lost aneusomic chromosome" ; rdfs:subClassOf obo:GENO_0000346, [ a owl:Restriction ; owl:hasValue 0 ; owl:onProperty obo:GENO_0000678 ] . obo:GENO_0000343 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A large deletion or terminal addition of part of some non-homologous chromsosome, as the result of an unbalanced translocation." ; obo:IAO_0000116 "Novel sequence features gained in a genome are considered to be sequence alterations, including aneusomic chromosome segments gained through unbalanced translocation events, entire aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that becoome part of the heritable genome of a cell or organism." ; obo:IAO_0000118 "aneuploid chromosomal segment", "aneusomic chromosomal subregion/segment", "partial aneusomic chromosomal element" ; a owl:Class ; rdfs:comment "Aneusomic chromosomal parts are examples of \"partial aneuploidy\" as described in http://en.wikipedia.org/wiki/Aneuploidy: \"The terms \"partial monosomy\" and \"partial trisomy\" are used to describe an imbalance of genetic material caused by loss or gain of part of a chromosome. In particular, these terms would be used in the situation of an unbalanced translocation, where an individual carries a derivative chromosome formed through the breakage and fusion of two different chromosomes. In this situation, the individual would have three copies of part of one chromosome (two normal copies and the portion that exists on the derivative chromosome) and only one copy of part of the other chromosome involved in the derivative chromosome.\"" ; rdfs:label "aneusomic chromosomal part" ; rdfs:subClassOf obo:SO_0000830, obo:SO_0001059, [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000513 ] . obo:GENO_0000344 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A part of some non-homologous chromosome that has been gained as the result of an unbalanced translocation event." ; obo:IAO_0000118 "duplicate partial aneuploid chromosomal element", "translocated duplicate chromosomal element", "translocated duplicate chromosomal segment" ; a owl:Class ; rdfs:comment "Such additions of translocated chromosomal parts confer a trisomic condition to the duplicated region of the chromsome, and are thus considered to be 'variant single locus complements' in virtue of an abnormal number of features at a particular genomic location, rather than abnormal sequence within the location." ; rdfs:label "gained aneusomic chromosomal segment" ; rdfs:subClassOf obo:GENO_0000343 . obo:GENO_0000345 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A deletion of a terminal portion of a chromosome resulting from an unbalanced translocation to another chromosome." ; obo:IAO_0000116 "In our model, we consider this chromosomal region to be monosomic, and thus a variant single locus complement" ; obo:IAO_0000118 "dropped partial anneuploid chromosomal element", "translocated absent chromosomal segment", "truncated chromosome terminus" ; a owl:Class ; rdfs:comment """This is not a deletion in the sense defined by the Sequence Ontology in that it is not the result of an 'excision' of nucleotides, but an unbalanced translocation event. The allelic complement that results is comprised of the terminus or junction represented by this lost chromosomal segment, and the remaining normal segment in the homologous chromosome. The lost aneusommic chromosomal segment is typically accommpanied by a gained aneusomic chromosomal segment from another chromosome. Loss of translocated chromosomal parts can confer a monosomic condition to a region of the chromsome. This results in a 'variant single locus complement' - in virtue of an abnormal number of features at a particular locus, rather than abnormal sequence within the locus.""" ; rdfs:label "lost aneusomic chromosomal segment" ; rdfs:subClassOf obo:GENO_0000343, [ a owl:Restriction ; owl:hasValue 0 ; owl:onProperty obo:GENO_0000678 ] . obo:GENO_0000346 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A complete chromosome that has been abnormally duplicated, or the absense of a chromosome that has been lost, typically as the result of a non-disjunction event or unbalanced translocation" ; obo:IAO_0000118 "complete aneusomic chromosome" ; a owl:Class ; rdfs:comment """Large sequence features gained in a genome are considered to be sequence alterations (akin to insertions), including aneusomic chromosome segments gained through unbalanced translocation events, entrie aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that become part of the heritable gneme of a cell or organism. Similarly, large sequence features lost from genome are akin to deletions and therefore also considered sequence alterations. This includes the loss of chromosomal segments through unbalanced translocation events, and the loss of entire chromosomes through a non-disjunction event during replication.""" ; rdfs:label "aneusomic chromosome" ; rdfs:subClassOf obo:SO_0000340, obo:SO_0001059, [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000513 ] . obo:GENO_0000351 obo:IAO_0000116 "Stub class to serve as root of hierarchy for imports of biological processes from GO-BP." ; a owl:Class ; rdfs:label "biological process" ; rdfs:subClassOf obo:BFO_0000015 . obo:GENO_0000359 obo:IAO_0000115 "shortcut relation used to link a phenotype directly to a genotype of an organism" ; obo:IAO_0000118 "is_phenotype_of_organism_with_genotype", "is_phenotype_with_genotype", "phenotype_has_genotype" ; a owl:ObjectProperty ; rdfs:comment """Might expand to something like: phenotype and (is_phenotype_of some (organism and (has_part some ('material genome' and (is_subject_of some (genome and (is_specified_by some genotype)))))))""" ; rdfs:label "obsolete_is_phenotype_of_genotype" ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000368 obo:IAO_0000115 "A relation to link variant loci, phenotypes, or disease to the type of inheritance process they are involved in, based on how the genetic interactions between alleles at the causative locus determine the pattern of inheritance of a specific phenotype/disease from one generation to the next." ; obo:IAO_0000116 "Exploratory/temporary property, as we formalize our phenotypic inheritance model." ; a owl:ObjectProperty ; rdfs:label "obsolete_participates_in_inheritance_process" ; rdfs:range obo:GENO_0000141 ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000382 obo:IAO_0000115 "A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is variant in terms of its sequence, position, or expression." ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "has_variant_part"@en ; rdfs:subPropertyOf obo:GENO_0000654 ; owl:inverseOf obo:GENO_0000383 . obo:GENO_0000383 a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "is_variant_part_of"@en ; rdfs:subPropertyOf obo:GENO_0000655 . obo:GENO_0000385 obo:IAO_0000115 "A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is not variant." ; obo:IAO_0000118 "has_reference_sequence_part" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "has_reference_part" ; rdfs:subPropertyOf obo:GENO_0000654 ; owl:inverseOf obo:GENO_0000387 . obo:GENO_0000387 a owl:ObjectProperty ; rdfs:label "is_reference_part_of" ; rdfs:subPropertyOf obo:GENO_0000655 . obo:GENO_0000391 obo:IAO_0000115 "A zygosity quality inhering in a 'single locus complement' in a genome with a normal ploidy of two (i.e. two copies of autosomal chromosomes). Disomic zygosity terms describe the degree of similarity of the two sequence features that reside at a particular location across homozygous chromosomes (or the state of being the only feature at a given locus in the case of hemizygosity)." ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "disomic zygosity" ; rdfs:subClassOf obo:GENO_0000133 . obo:GENO_0000392 obo:IAO_0000115 "A zygosity quality inhering in a 'single locus complement' in a genome with an abnormal ploidy at the location (i.e. an autosomal locus with one or three copies in a diploid genome)." ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "aneusomic zygosity" ; rdfs:subClassOf obo:GENO_0000133 . obo:GENO_0000393 oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "trisomic homozygous" ; rdfs:subClassOf obo:GENO_0000392 . obo:GENO_0000394 oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "trisomic heterozygous" ; rdfs:subClassOf obo:GENO_0000392 . obo:GENO_0000402 obo:IAO_0000115 "A heterozygous quality inhering in a single locus complement comprised of two different varaint alleles and no wild type locus. (e.g.fgf8a/fgf8a)" ; obo:IAO_0000118 "trans-heterozygous" ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "compound heterozygous" ; rdfs:subClassOf obo:GENO_0000135 . obo:GENO_0000408 obo:IAO_0000112 " is_allele_of the 'danio rerio fgf8a' gene locus." ; obo:IAO_0000115 "A relation linking an instance of a variable feature (aka an allele) to a genomic location/locus it occupies. This is typically a gene locus, but a feature may be an allele of other types of named loci such as QTLs, or alleles of some unnamed locus of arbitrary size." ; obo:IAO_0000116 """Domain = allele Range = genomic locus (but in practice it is common to use a punned gene class IRI as the subject of this relation).""", "Note that the allele is not necessarily an instance of the danio rerio fgf8a gene class, given that we adopt the SO definition of genes as 'producing a functional product'. If the allele is nonfunctional or null, it is an allele_of the danio rerio fgf8a gene class, but not an instance (rdf:type) of this class. It would, however, bean instance of a 'danio rerio fgf8a gene allele' class - because being a 'gene allele' as defined in GENO requires only occupying the genomic position where for a gene, but not necessarily producing a functional product." ; obo:IAO_0000118 "is_sequence_variant_of" ; a owl:ObjectProperty ; rdfs:comment """To allow users to make important distinctions in discourse and modeling, GENO clearly separates the notions/levels of 'biological sequence', 'sequence feature', and 'sequence location' ('genomic locus' when found in a genome). This sets up an important terminological nuance when it comes to alleles, where we believe it correct to say that a particular genomic feature is an alleles_of some genomic locus (as opposed to an allele_of some sequence or some feature). This is typically a gene locus, but even insertions falling outside of genes are considered alleles_of the locus they alter (e.g. alleles of other types of named loci such as QTLs, or alleles of some unnamed locus of arbitrary size). While conceptually it is most correct to say features are alleles_of some genomic locus, it is common practice to say that they are alleles of the class of feature defined to reside at that locus (typically a gene). Accordingly, we may write things like \"fgf8a is an allele of the Danio rerio fgf8a gene\", and we may create data where fgf8a is asserted as an allele_of the fgf8a gene class IRI. But here we mean more precisely that it is an allele of the locus at which the fgf8a gene resides. Allowing for this means that we dont have to create 'feature-based location/locus' terms mirroing all feature class terms already in exiistence (e.g. for every gene). It is important to be clear that the location/locus that a feature is an allele_of is defined exclusively by its genomic position, and not on the sequence it may contains. This is particularly relevant when considering transgenic insertions. For example, this means that the insertion of the S. cerevisiae GAL4 gene sequence within the D. melanogaster Bx gene locus would create an allele of the D. melanogaster Bx gene, but not an allele of the S. cerevisiae GAL4 gene. The transgene that results from such an insertion, while expressing S. cerevisiae GAL4 gene sequence, is not an allele of this gene because it does not reside at the S. cerevisiae GAL4 locus. This departs from how some databases use the term 'allele' - where transgenes expressing an exogenous gene are considered to be alleles of the exogenous genes they carry. For example, in the example above, Flybase describes the S. cerevisiae GAL4 transgene as an allele_of the S. cerevisiae GAL4 gene (and gives it the allele identifier FBal0040476). A GENO representation on the other hand would say that the S. cerevisiae GAL4 transgene derives_sequence_from the S. cerevisiae GAL4 gene, but is not an allele_of this gene. In a GENO model, FBal0040476 would be typed as a transgene insertion, but not considered an allele_of the Scer\\GAL4 gene. At the end of the day, it's just semantics, but worth clarifying given the ubiquity and variable use of the term 'allele'. The GENO model attempts to define and adhere to the principled notion of positionally-defined 'alleles', and functionally-defined 'transgenes'.""" ; rdfs:domain obo:GENO_0000481 ; rdfs:label "is_allele_of" ; rdfs:subPropertyOf obo:GENO_0000418 ; owl:inverseOf obo:GENO_0000413 . obo:GENO_0000410 obo:IAO_0000115 "A relation used to link a variant locus instance to the gene class it is a variant of (in terms of its sequence or expression level)." ; obo:IAO_0000118 "is_variant_instance_of" ; obo:IAO_0000231 "formerly grouped is_allele_of and is_expression_variant_of proerpties under feature to class proeprty (now renmaed has_affected_locus)" ; a owl:ObjectProperty ; rdfs:comment """Domain = genomic feature instance Range = punned gene class IRI""" ; rdfs:label "obsolete_is_genetic_variant_of" ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000411 obo:IAO_0000115 "A relation linking a gene class to a sequence-varaint or expression-variant of the gene." ; obo:IAO_0000118 "has_variant_instance" ; obo:IAO_0000231 "formerly grouped has_allele and has_expression_variant proerpties under cllass to feature property (now renamed locus_affected_by)" ; a owl:ObjectProperty ; rdfs:comment """Domain = punned gene class Range = genomic feature""" ; rdfs:label "obsolete_has_genetic_variant" ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000413 obo:IAO_0000115 "A relation linking a gene class to one of its sequence-variant alleles." ; obo:IAO_0000116 """Domain = punned gene class Range = allele""" ; obo:IAO_0000118 "has_sequence_variant" ; a owl:ObjectProperty ; rdfs:label "has_allele" ; rdfs:subPropertyOf obo:GENO_0000445 . obo:GENO_0000414 obo:IAO_0000115 "A relation between a gene targeting reagent (e.g. a morpholino or RNAi) and the class of gene it targets." ; a owl:ObjectProperty ; rdfs:comment "This is intended to be used as an instance-class relation, used for linking an instance of a gene targeting reagent to the class of gene whose instances it targets." ; rdfs:label "targets_gene" ; rdfs:subPropertyOf obo:GENO_0000418 ; owl:inverseOf obo:GENO_0000447 . obo:GENO_0000415 obo:IAO_0000115 "A sequence feature that references some biological macromolecule applied as a reagent in an experiment or technique (e.g. a morpholino expression plasmid, or oligonucleotide probe)" ; obo:IAO_0000116 "replaced with SO:engineered_region" ; obo:IAO_0000118 "extra-genomic sequence" ; a owl:Class ; rdfs:label "obsolete reagent sequence feature" ; owl:deprecated true . obo:GENO_0000418 obo:IAO_0000115 "A relation that holds between an instance of a geneetic variation and a genomic feature (typically a gene class) that is affected in its sequence or expression." ; a owl:ObjectProperty ; rdfs:comment "This class to organizes all relations used to link genetic variation instances of any type to genomic feature classes they effect. For example, is_allele_of links a gene allele instance to its gene class (genes are represented as classes in our OWL model). Such links support phenotype propagation from alleles to genes for Monarch Initiative use cases. Use of these properties effectively puns gene class IRIs into owl:individuals in a given rdf datset." ; rdfs:label "has_affected_feature" ; owl:inverseOf obo:GENO_0000445 ; owl:propertyChainAxiom (obo:GENO_0000382 obo:GENO_0000418 ), (obo:GENO_0000383 obo:GENO_0000418 ) . obo:GENO_0000443 obo:IAO_0000115 "A relation between an expression-variant gene (ie integrated transgenes or knockdown reagent targeted genes), and the class of gene it represents." ; obo:IAO_0000116 """Domain = expression variant feature. Range = punned gene class""" ; a owl:ObjectProperty ; rdfs:comment "This relation links an expression-variant gene instance (targeted or transgenic) to the class of gene that it preresents. For transient transgenes, this is the gene, the coding sequence need only to contain as part an expressed region from a given gene to stand in an is_expression_variant_of relation to the gene class." ; rdfs:label "is_expression_variant_of" ; rdfs:subPropertyOf obo:GENO_0000418 ; owl:inverseOf obo:GENO_0000449 . obo:GENO_0000445 obo:IAO_0000115 "A relation between a genomic feature class (typically a gene class) and an instance of a sequence feature or qualified sequence feature that represents or affects some change in the sequence or expression of the genomic feature." ; obo:IAO_0000118 "class_to_feature_relation" ; a owl:ObjectProperty ; rdfs:comment "This is an organizational grouping class to collect all relations used to link genomic feature classes (typically genes) to instance of a genomic feature sequence feature or qualified sequence feature. For example, linking a gene class IRI to an instance of an allele of that gene class. Such links support phenotype propagation from features/variants to genes (e.g. for Monarch Initiative use cases)" ; rdfs:label "is_feature_affected_by" . obo:GENO_0000447 obo:IAO_0000115 "A relation between a gene class and a gene targeting reagent that targets it." ; obo:IAO_0000118 "is_target_of" ; a owl:ObjectProperty ; rdfs:comment """Domain = punned gene class Range = gene knockdown reagent""" ; rdfs:label "is_gene_target_of" ; rdfs:subPropertyOf obo:GENO_0000445 . obo:GENO_0000449 obo:IAO_0000115 "A relation linking a gene class to one of an expression-variant of that gene.." ; obo:IAO_0000116 """Domain = punned gene class Range = expression variant feature""" ; obo:IAO_0000118 "has_expression_variant_instance" ; a owl:ObjectProperty ; rdfs:label "has_expression_variant" ; rdfs:subPropertyOf obo:GENO_0000445 . obo:GENO_0000458 oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:comment "a heterozygous quality inhering in a single locus complement comprised of one variant allele and one wild-type/reference allele (e.g.fgf8a)" ; rdfs:label "simple heterozygous" ; rdfs:subClassOf obo:GENO_0000135 . obo:GENO_0000460 obo:IAO_0000115 "A structurally or functionally defined component of a transgene (e.g. a promoter, a region coding for a fluorescent protein tag, etc)" ; a owl:Class ; rdfs:label "transgene part" ; rdfs:subClassOf obo:GENO_0000666, [ a owl:Restriction ; owl:onProperty obo:RO_0002525 ; owl:someValuesFrom obo:SO_0000902 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000666 [ a owl:Restriction ; owl:onProperty obo:RO_0002525 ; owl:someValuesFrom obo:SO_0000902 ] ) ] . obo:GENO_0000476 obo:IAO_0000115 "An attribute inhering in a sequence feature that varies from some designated reference in virtue of alterations in its sequence or expression level" ; a owl:Class ; rdfs:label "variant"@en ; rdfs:subClassOf obo:GENO_0000773 . obo:GENO_0000477 obo:IAO_0000115 "An attribute inhereing in a sequence feature for which there is more than one version fixed in a population at some significant percentage (typically 1% or greater), where the locus is not considered to be either reference or a variant." ; a owl:Class ; rdfs:label "polymorphic"@en ; rdfs:subClassOf obo:GENO_0000773 . obo:GENO_0000480 obo:IAO_0000115 "An attribute inhering in a feature bearing a sequence alteration that is present at very low levels in a given population (typically less than 1%), or that has been experimentally generated to alter the feature with respect to some reference sequence." ; a owl:Class ; rdfs:label "mutant"@en ; rdfs:subClassOf obo:GENO_0000773 . obo:GENO_0000481 obo:IAO_0000115 "A sequence feature (continuous extent of biological sequence) that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)" ; obo:IAO_0000116 "This class was created largely as a modeling convenience to support organizing data for schema definitions. We may consider obsoleting it if it ends up causing confusion or complicating classification of terms in the ontology." ; a owl:Class ; rdfs:comment """1. A feature being 'of genomic origin' here means only that its sequence has been located to the genome of some organism by alignment with some reference genome. This is because the sequence was originally identified in, or artificially created to replicate, sequence from an organism's genome. 2. The location of a genomic feature is defined by start and end coordinates based on alignment with a reference genome. Genomic features can span any size from a complete chromosome, to a chromosomal band or region, to a gene, to a single base pair or even junction between base pairs (this would be a sequence feature with an extent of zero). 3. As sequence features, instances of genomic features are identified by both their inherent *sequence* and their *position* in a genome - as determined by an alignment with some reference sequence. Accordingly, the 'ATG' start codon in the coding DNA sequence of the human AKT gene and the 'ATG' start codon in the human SHH gene represent two distinct genomic features despite having he same sequence, in virtue of their different positions in the genome.""" ; rdfs:label "genomic feature"@en ; rdfs:subClassOf obo:GENO_0000897, obo:SO_0000110, [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:SO_0001026 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000239 ; owl:someValuesFrom obo:GENO_0000960 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000903 ; owl:someValuesFrom obo:GENO_0000902 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0000110 [ a owl:Restriction ; owl:onProperty obo:GENO_0000903 ; owl:someValuesFrom obo:GENO_0000902 ] ) ] . obo:GENO_0000482 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A nucleic acid molecule that contains one or more sequences serving as a template for gene expression in a biological system (ie a cell or virion)." ; a owl:Class ; rdfs:comment "This class is different from genomic material in that genomic material is necessarily heritable, while genetic material includes genomic material, as well as any additional nucleic acids that participate in gene expression resulting in a cellular or organismal phenotype. So things like transiently transfected expression constructs would qualify as 'genetic material but not 'genomic material'. Things like siRNAs and morpholinos affect gene expression indirectly, (ie are not templates for gene expression), and therefore do not qualify as genetic material." ; rdfs:label "genetic material"@en ; rdfs:subClassOf obo:CHEBI_33696 . obo:GENO_0000484 a obo:IAO_0000102, owl:NamedIndividual ; rdfs:label "exploratory term"@en . obo:GENO_0000486 obo:IAO_0000115 "A relation between two sequence features at a given genomic locus that vary in their sequence or level of expression." ; obo:IAO_0000231 "Decided there was no need for a contrasting is_expression_variant_with property, so removed it and this parent grouping property." ; a owl:ObjectProperty ; rdfs:comment "This proeprty is most commonly used to relate two different alleles of a given gene. It is not a relation between an allele and the gene it is a variant of." ; rdfs:label "obsolete_is_variant_with"@en ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000488 obo:IAO_0000115 "A relation between two instances of a given gene that vary in their level of expression as a result of external factors influencing expression (e.g. gnee-knockdown reagents, epigenetic modification, alteration of endogenous gene-regulation pathways)." ; a owl:ObjectProperty ; rdfs:label "obsolete_is_expression_variant_with"@en ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000491 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "An allele that is variant with respect to some wild-type allele, in virtue of its being very rare in a population (typically <1%), or being an experimentally-induced alteration that derives from a wild-type feature in a given strain." ; obo:IAO_0000119 "Based on use of 'mutant' as described in PMID: 25741868 ACMG Guidelines" ; obo:IAO_0000231 """Not required for any specific use case at this point so removed for simplicity. Formely asserted as allele and inferred as varaint allele. Eq class definition: allele and (mutation or ('has subsequence' some mutation))""" ; a owl:Class ; rdfs:comment "'Mutant' is typically contrasted with 'wild-type', where 'mutant' indicates a natural but very rare allele in a population (typically <1%), or an experimentally-induced variation that derives from a wild-type background locus for a given strain, which can be selected for in establishing a mutant line." ; rdfs:label "obsolete mutant allele" ; owl:deprecated true . obo:GENO_0000492 obo:IAO_0000115 "A sequence alteration that is very rare allele in a population (typically <1%), or an experimentally-induced variation that derives from a wild-type feature in a given strain." ; a owl:Class ; rdfs:label "mutation"@en ; rdfs:subClassOf obo:SO_0001059, [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000501 ] . obo:GENO_0000494 obo:IAO_0000115 "A genetic feature that is not part of the chromosomal genome of a cell or virion, but rather a stable and heritable element that is replilcated and passed on to progeny (e.g. a replicative plasmid or transposon)" ; obo:IAO_0000116 "Consider replacing with SO_0001038 ! extrachromosomal_mobile_genetic_element" ; obo:IAO_0000118 "episomal replicon" ; obo:IAO_0000231 "Extrachromosomal replicons are replicated and passed on to descendents, and thus part of the heritable genome of a cell or organism. In cases where the presence of such a replicon is novel or aberrant (i.e. not included in the reference for that genome), the replicon is considered a 'sequence alteration'." ; a owl:Class ; rdfs:label "extrachromosomal replicon"@en ; rdfs:subClassOf obo:GENO_0000481, [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000139 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000481 [ a owl:Class ; owl:complementOf [ a owl:Restriction ; owl:onProperty obo:GENO_0000248 ; owl:someValuesFrom obo:SO_0000340 ] ] [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000139 ] ) ] . obo:GENO_0000495 obo:IAO_0000118 "expression construct feature" ; a owl:Class ; rdfs:label "expression construct"@en ; rdfs:subClassOf obo:GENO_0000856 . obo:GENO_0000497 obo:IAO_0000115 "An allele that is fixed in a population at some stable level, typically > 1%. Polymorphic alleles reside at loci where more than one version exists at some signifcant frequency in a population." ; obo:IAO_0000119 "PMID: 25741868 ACMG Guidelines" ; a owl:Class ; rdfs:comment "Polymorphic alleles are contrasted with mutant alleles (extremely rare variants that exist in <1% of a population), and 'wild-type alleles' (extremenly common variants present in >99% of a population). Polymorphic alleles exist in equilibrium in a given population somewhere between these two extremes (i.e. >1% and <99%)." ; rdfs:label "polymorphic allele" ; rdfs:subClassOf obo:GENO_0000512 . obo:GENO_0000498 obo:IAO_0000115 "A polymorphic allele that is present at the highest frequency relative to other polymorphic variants at the same genomic location." ; obo:IAO_0000118 "major allele"@en ; a owl:Class ; rdfs:label "major polymorphic allele" ; rdfs:subClassOf obo:GENO_0000497 . obo:GENO_0000499 obo:IAO_0000115 "A polymorphic allele that is not present at the highest frequency among all fixed variants at the locus (i.e. not the major polymorphic allele at a given location)." ; obo:IAO_0000118 "minor allele"@en ; a owl:Class ; rdfs:label "minor polymorphic allele" ; rdfs:subClassOf obo:GENO_0000497 . obo:GENO_0000500 obo:IAO_0000115 "A polymorphic allele that is determined from the sequence of a recent ancestor in a phylogentic tree." ; obo:IAO_0000118 "ancestral allele"@en ; a owl:Class ; rdfs:label "ancestral polymorphic allele" ; rdfs:subClassOf obo:GENO_0000497 . obo:GENO_0000501 obo:IAO_0000115 "An allele representing a highly common varaint (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are often compared." ; obo:IAO_0000118 "wild-type allele" ; a owl:Class ; rdfs:comment """'Wild-type' is typically contrasted with 'mutant', where 'wild-type' indicates a highly prevalent allele in a population (typically >99%), and/or some prototypical allele in a background genome that serves as a basis for some experimental alteration to generate a mutant allele, which can be selected for in establishing a mutant strain. The notion of wild-type alleles is more common in model organism databases, where specific mutations are generated against a wild-type reference feature. Wild-type alleles are typically but not always used as reference alleles in sequence comparison/analysis applications. More than one wild-type sequence can exist for a given feature, but typically only one allele is deemed wild-type iin the context of a single dataset or analysis.""" ; rdfs:label "wild-type allele" ; rdfs:subClassOf obo:GENO_0000512 . obo:GENO_0000502 obo:IAO_0000118 "wild-type gene allele"@en ; a owl:Class ; rdfs:comment "A gene allele representing the most common varaint in a population (typically >99% frequency), that exhibits canonical function, and against which rare and/or non-functional mutant gene alleles are compared in characterizing the phenotypic consequences of genetic variation." ; rdfs:label "wild-type gene" ; rdfs:subClassOf obo:GENO_0000501, obo:SO_0000704 . obo:GENO_0000504 obo:IAO_0000115 "A gene altered in its expression level in the context of some experiment as a result of being targeted by gene-knockdown reagent(s) such as a morpholino or RNAi." ; a owl:Class ; rdfs:comment "The identity of a given instance of a reagent-targeted gene is dependent on the experimental context of its knock-down - specifically what reagent was used and at what level. For example, the wild-type shha zebrafish gene targeted in epxeriment 1 by morpholino1 annd in experiment 2 by morpholino 2 represent two distinct instances of a 'reagent-targeted gene', despite sharing the same sequence and position." ; rdfs:label "reagent targeted gene"@en ; rdfs:subClassOf obo:GENO_0000529, [ a owl:Restriction ; owl:onProperty obo:GENO_0000231 ; owl:someValuesFrom obo:GENO_0000534 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000447 ; owl:someValuesFrom obo:GENO_0000533 ] . obo:GENO_0000506 obo:IAO_0000115 "A transgene that is delivered as part of a DNA expression construct into a cell or organism in order to transiently express a specified product (i.e. it has not integrated into the host genome)." ; obo:IAO_0000118 "experimentally-expressed transgene", "extrinsic transgene"@en ; a owl:Class ; rdfs:label "transiently-expressed transgene" ; rdfs:subClassOf obo:GENO_0000529 . obo:GENO_0000511 obo:IAO_0000115 "An allele attribute describing a highly common variant (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are compared." ; a owl:Class ; rdfs:label "wild-type"@en ; rdfs:subClassOf obo:GENO_0000773 . obo:GENO_0000512 obo:IAO_0000115 "One of a set of sequence features known to exist at a particular genomic location." ; obo:IAO_0000116 """A landsacpe review found mostly gene-centric definitions of 'allele' that represented a particular version of a gene, or variation within a gene sequence [1][2][3][4][5][6][6a]. But we also found 'allele' used to refer to other types and extents of variation - including single nucleotide polymorphisms, repeat regions, and copy number variations [7][8][9][10][11], where such variations don't neccessarily impact a gene. To be maximally accommodating of how this term is used across research communities, GENO defines 'allele' broadly and allow alleles can span any locus or extent of sequence. While 'alleles' encountered in public datases typically overlap a gene, many do not. But GENO does define the 'gene allele' class as a subtype of 'allele' to refers more specifically to a specifc version of an entire gene. [1] https://isogg.org/wiki/Allele (retrieved 2018-03-17) [2] http://semanticscience.org/resource/allele (retrieved 2018-03-17) [3] https://en.wikipedia.org/wiki/Allele (retrieved 2018-03-17) [4] https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/allele (retrieved 2018-03-17) [5] http://purl.obolibrary.org/obo/SO_0001023 (retrieved 2018-03-17) [6] http://purl.obolibrary.org/obo/NCIT_C16277 (retrieved 2018-03-17) [6a] https://www.ncbi.nlm.nih.gov/mesh/68000483 [7] https://www.snpedia.com/index.php/Allele (retrieved 2018-03-17) [8] https://en.wikipedia.org/wiki/Single-nucleotide_polymorphism (retrieved 2018-03-17) [9] http://purl.obolibrary.org/obo/OGI_0000008 (retrieved 2018-03-17) [10] http://purl.obolibrary.org/obo/OBI_0001352 (retrieved 2018-03-17) [11] http://purl.phyloviz.net/ontology/typon#Allele (retrieved 2018-03-17)""" ; obo:IAO_0000118 "variable feature"@en ; a owl:Class ; rdfs:comment """An allele is a seqeunce feature at a genomic location where variation occurs (i.e. where >1 different sequence is known to exist). An allele can span only the extent of sequence known to vary (e.g. a single base SNP, or short insertion), or it can span a larger extent that includes one or more variable features as proper parts (e.g. a 'gene allele' that spans the extent of an entire gene which contains several sequence alterations). Alleles can carry 'reference' or 'variant' sequence - depending on whether the its 'state' matches that considered to be the reference at that location. Alleles whose state differs from the reference are called 'variant alleles', and those that match the reference are called 'reference alleles'. What is considered the 'reference' state at a particular location may vary, depending on the context/goal of a particular analysis. A 'sequence alteration' is a 'variant allele' that varies along its entire extent (i.e every position varies from that of some defined reference sequence).""" ; rdfs:label "allele" ; rdfs:subClassOf obo:GENO_0000481, [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000481 ] ; owl:equivalentClass _:genid505 . obo:GENO_0000513 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "a sequence attribute of a chromosome or chromosomal region that has been abnormally duplicated or lost, as the result of a non-disjunction event or unbalanced translocation." ; a owl:Class ; rdfs:label "aneusomic"@en ; rdfs:subClassOf obo:GENO_0000773 . obo:GENO_0000514 a obo:IAO_0000102, owl:NamedIndividual ; rdfs:label "exemplar term"@en . obo:GENO_0000515 obo:IAO_0000115 "An allele of a gene that contains some sequence alteration." ; a owl:Class ; rdfs:comment "A gene allele is 'variant' in virtue of its containing a sequence alteration that varies from some reference gene standard. But note that a gene allele that is variant in one context/dataset can be considered a reference in another context/dataset." ; rdfs:label "variant gene allele" ; rdfs:subClassOf obo:GENO_0000002, obo:GENO_0000014, [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:SO_0001059 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000641 ; owl:someValuesFrom obo:SO_0000704 ] ; owl:equivalentClass _:genid510 . obo:GENO_0000516 obo:IAO_0000112 """The set of both shha gene alleles in a diiploid zebrafish genome, e.g. fgf8a. The collection of the individual base-pairs present at the position 24126737 in both copies of chromosome 5 in a diploid human genome.""" ; obo:IAO_0000115 "A set representing the complement of all sequence features occupying a particular genomic location across all homologous chromosomes in the genome of a single organism." ; obo:IAO_0000116 "TO DO: show a VCF representation of this example. Consider making 'allelic complement' the primary label." ; obo:IAO_0000118 "allelic complement", "homologous allele complement", "single locus feature complement" ; a owl:Class ; rdfs:comment """A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a complement may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features. Here, a 'single locus complement' is the set of all alleles at a specified location in a particular genome. This complement is typically a pair of two features in a diploid genome (with two copies of each chromosome). E.g. a gene pair, a QTL pair, a nucleotide pair for a SNP, or a pair of entire chromosomes. The fact that we are counting how many copies of the same *sequence* exist in a genome, as opposed to how many of the same *feature*, is what sets feature-level concepts like 'single locus complement'. apart from sequence-level concepts like 'copy number complement'. To illustrate the difference, consider a duplication event that creates a new copy of the human APOE gene on a different chromosome. This creates an entirely new sequence feature at a distinct locus from that of the original APOE gene. The 'copy number complement' for sequence defined by the APOE gene locus would have a count of three, as this sequence is present three times in the genome. But the 'single locus complement' at the APOE gene locus would still have a count of two - because the duplicated copy is at a different location in the genome, and therefore does not represent a copy of the APOE locus.""" ; rdfs:label "single locus complement" ; rdfs:subClassOf obo:GENO_0000660 . obo:GENO_0000524 obo:IAO_0000112 """In an experiment where shha is targeted by MO1 and shhb is overexpressed from a transgenic expression construct, the extrinsic genotype captures the altered expression status of these two genes. A notation for representing such a genotype might describe this scenario as: shha; shhb This notation parallels those used for more traditional 'intrinsic' genotypes, where the affected gene is presented with its alteration in angled brackets < >. In the extrinsic genotype shown here, the variation in shha is affected by a specific concentration of an shha-targeting morpholino (instead of a mutation in the shha gene). And the variation in shhb is affected by its overexpression from a pFLAG Shhb expression construct.""" ; obo:IAO_0000115 "A specification of the known state of gene expression across a genome, and how it varies from some baseline/reference state." ; obo:IAO_0000116 """We acknowledge that this is not a 'genotype' in the traditional sense, but this terminological choice highlights similarities that play out in parallel modeling of intrinsic and extrinsic genotype partonomies, and parallel syntactic formats for labeling instances of these genotypes. Our rationale here is that what we care about from perspective of G2P associations is identifying genomic features that impact phenotype - where experimental approaches include permanent introduction of intrinsic modifications to genomic sequence, and transient introduction of extrinsic factors that modify expression of specific genes. As the former is described by the traditional notion of a genotype, it seems a rational leap to consider the latter akin to an 'extrinsic genotype' wherein the alterations are externally applied rather than inherent to the genome. Finally, there is some precedent to thinking about such extrinsic modifications in terms of a genotype, in the EFO:0000513 ! genotype: \"The total sum of the genetic information of an organism that is known and relevant to the experiment being performed, including chromosomal, plasmid, viral or other genetic material which has been introduced into the organism either prior to or during the experiment.\"""" ; obo:IAO_0000118 "experimental genotype", "expression genotype" ; a owl:Class ; rdfs:comment """An extrinsic genotype describes variation in the 'expression level' of genes in a cell or organism, as mediated by transient, gene-specific experimental interventions such as RNAi, morpholinos, TALENS CRISPR, or construct overexpression. This concept is relevant primarily for model organisms and systems that are subjected to such interventions to determine how altered expression of specific genes may impact organismal or cellular phenotypes in the context of a particular experiment. The 'extrinsic genotype' concept is contrasted with the more familiar notion of an 'intrinsic genotype', describing variation in the inherent genomic sequence (i.e. 'allelic state'). In G2P research, interventions affecting both genomic sequence and gene expression are commonly applied in order to assess the impact specific genomic features can have on phenotype and disease. It is in this context that we chose to model 'extrinsic' alterations in expression as genotypes - to support parallel conceptualization and representation of these different types of genetic variation that inform the discovery of G2P associations.""" ; rdfs:label "extrinsic genotype"@en ; rdfs:subClassOf obo:GENO_0000536 . obo:GENO_0000525 obo:IAO_0000115 "A genotype that describes the total intrinsic and extrinsic variation across a genome at the time of a phenotypic assessment (where 'intrinsic' refers to variation in genomic sequence, as mediated by sequence alterations, and 'extrinsic' refers to variation in gene expression, as mediated through transient gene-specific interventions such as gene knockdown reagents or overexpression constructs)." ; obo:IAO_0000116 "Closest concept/definition we could find for this concept was for EFO:0000513 ! genotype: \"The total sum of the genetic information of an organism that is known and relevant to the experiment being performed, including chromosomal, plasmid, viral or other genetic material which has been introduced into the organism either prior to or during the experiment.\"" ; a owl:Class ; rdfs:comment "An effective genotype is meant to summarize all factors related to genes and their expression that influence an observed phenotype - including 'intrinsic' alterations in genomic sequence, and gene-specific 'extrinsic' alterations in expression transiently introduced at the time of the phenotypic assessment." ; rdfs:label "effective genotype"@en ; rdfs:subClassOf obo:GENO_0000536, [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:GENO_0000524 ], [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:GENO_0000719 ] . obo:GENO_0000527 obo:IAO_0000115 "A set comprised of *all* reagent-targeted genes in a single genome in the context of a given experiment (e.g. the zebrafish shha and shhb genes in a zebrafish exposed to morpholinos targeting both of these genes)." ; a owl:Class ; rdfs:comment "A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a complement may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features. For example, a 'reagent-targeted gene complement' is the set of all genes in a particular genome that are targeted by reagents in the context of a particular experiment." ; rdfs:label "reagent-targeted gene complement"@en ; rdfs:subClassOf obo:GENO_0000715, [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:GENO_0000504 ] . obo:GENO_0000528 obo:IAO_0000115 "The set of all transgenes trransiently expressed in a biological system in the context of a given experiment." ; obo:IAO_0000118 "experimental transgene complement"@en ; a owl:Class ; rdfs:label "transiently-expressed transgene complement" ; rdfs:subClassOf obo:GENO_0000715, [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:GENO_0000506 ] . obo:GENO_0000529 obo:IAO_0000112 "Consider wild-type zebrafish shha gene in the context of being targeted by morpholino1 vs morpholino 2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'expression-variant genes' because of their different external context. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants of the same gene can have potentially different associated phenotypes)." ; obo:IAO_0000115 "A gene altered in its expression level relative to some baseline of normal expression in the system under investigation (e.g. a cell line or model organism)." ; obo:IAO_0000116 "See SO classes under 'silenced gene' (e.g. 'gene silenced by RNA interference'). These seem to represent the concept of a qualified feature as I define it here, in that they are defined by alterations extrinsic to the sequence and position of the gene itself." ; obo:IAO_0000118 "expression allele" ; a owl:Class ; rdfs:comment """Expression-variant genes are altered in their expression level through some modification or intervention external to its sequence and position. These may include endogenous mechanisms (e.g. direct epigentic modification that impact expression level, or altered regulatory networks controlling gene expression), or experimental interventions (e.g. targeting by a gene-knockdown reagent, or being transiently expressed as part of a transgenic construct in a host cell or organism). The identity of a given instance of a experssion-variant gene is dependent on how its level of expression is manipulated in a biological system (i.e. via targeting by gene-knockdown reagents, or being transiently overexpressed). So expression-variant genes have the additional identity criteria of a genetic context of its material bearer (external to its sequence and position) that impacts its level of expression in a biological system.""" ; rdfs:label "expression-variant gene"@en ; rdfs:subClassOf obo:GENO_0000737, [ a owl:Restriction ; owl:onProperty obo:GENO_0000443 ; owl:someValuesFrom obo:SO_0000704 ] . obo:GENO_0000533 obo:IAO_0000118 "gene targeting reagent", "sequence targeting reagent" ; a owl:Class ; rdfs:label "gene knockdown reagent"@en ; rdfs:subClassOf obo:SO_0000804 . obo:GENO_0000534 obo:IAO_0000115 "A region within a gene that is specifically targeted by a gene knockdown reagent, typically in virtue of bearing sequence complementary to the reagent." ; obo:IAO_0000118 "targeted gene segment"@en ; a owl:Class ; rdfs:label "reagent-targeted gene subregion" ; rdfs:subClassOf obo:GENO_0000737 . obo:GENO_0000536 obo:IAO_0000115 "A specification of the genetic state of an organism, whether complete (defined over the whole genome) or incomplete (defined over a subset of the genome). Genotypes typically describe this genetic state as a diff between some variant component and a canonical reference." ; obo:IAO_0000116 "As information artifacts, genotypes specify the state of a genome be defining a diff between some canonical reference and a variant or alternate sequence that replaces the corresponding portion of the reference. We can consider a genotype then as a collection of these reference and variant features, along with some rule for operating on them and resolve a final single sequence. This is valid ontologically because we commit only to sequence features being GDCs - which allows for their concretization in either biological or informational patterns. Accordingly, a particular gene allele, such as shh, can be part of a genome in a biological sense and part of a genotype in an informational sense. This idea underpins the 'genotype partonomy' at the core of the GENO model that decomposes a complete genotype into its more fundamental parts, including alleles and allele complements, as described in the comment above." ; obo:IAO_0000119 """Core definition above adapted from the GA4GH VMC data model definition here: https://docs.google.com/document/d/12E8WbQlvfZWk5NrxwLytmympPby6vsv60RxCeD5wc1E/edit#heading=h.4e32jj4jtmsl (retrieved 2018-04-09). Note however that the VMC genotype concept likely is not intended to cover 'effective' and 'extrinsic' genotype concepts defined in GENO.""" ; a owl:Class ; rdfs:comment """1. Scope of 'Genetic State': 'Genetic state' is considered quite broadly in GENO to describe two general kinds of 'states'. First, is traditional notion of 'allelic state' - defined as the complement of alleles present at a particular location or locations in a genome (i.e. across all homologous chromosomes containing this location). Here, a genotype can describe allelic state at a specific locus in a genome (an 'allelic genotype'), or describe the allelic state across the entire genome ('genomic genotype'). Second, this concept can also describe states of genomic features 'extrinsic' to their intrinsic sequence, such as the expression status of a gene as a result of being specifically targeted by experimental interventions such as RNAi, morpholinos, or CRISPRs. 2. Genotype Subtypes: In GENO, we use the term 'intrinsic' for genotypes describing variation in genomic sequence, and 'extrinsic' for genotypes describing variation in gene expression (e.g. resulting from the targeted experimental knock-down or over-expression of endogenous genes). We use the term 'effective genotype' to describe the total intrinsic and extrinsic variation in a cell or organism at the time a phenotypic assessment is performed. Two more precise conccepts are subsumed by the notion of an 'intrinsic genotype': (1) 'allelic genotypes', which specify allelic state at a single genomic location; and (2) 'genomic genotypes', which specify allelic state across an entire genome. In both cases, allelic state is typically specified in terms of a differential between a reference and a set of 1 or more known variant features. 3. The Genotype Partonomy: 'Genomic genotypes' describing sequence variation across an entire genome are 'decomposed' in GENO into a partonomy of more granular levels of variation. These levels are defined to be meaningful to biologists in their attempts to relate genetic variation to phenotypic features. They include 'genomic variation complement' (GVC), 'variant single locus complement' (VSLC), 'allele', 'haplotype', 'sequence alteration', and 'genomic background' classes. For example, the components of the zebrafish genotype \"fgf8a; fgf3[AB]\", described at zfin.org/ZDB-FISH-150901-9362, include the following elements: - GVC: fgf8a; fgf3 (total intrinsic variation in the genome) - Genomic Background: AB (the reference against which the GVC is variant) - VSLC1: fgf8a (homozygous complement of gene alleles at one known variant locus) - VSLC2: fgf3 (heterozygous complement of gene alleles at another known variant locus) - Allele 1: fgf8a (variant version of the fgf8a gene, present in two copies) - Allele 2: fgf3 (variant version of the fgf3 gene, present in one copy) - Allele 3: fgf3<+> (wild-type version of the fgf3 gene, present in one copy) - Sequence Alteration1: (the specific mutation within the fgf8a gene that makes it variant) - Sequence Alteration2: (the specific mutation within the fgf3 gene that makes it variant) A graphical representation of this decomposition that maps each element to a visual depiction of the portion of a genome it denotes can be found here: https://github.com/monarch-initiative/GENO-ontology/blob/develop/README.md One reason that explicit representation of these levels is important is because it is at these levels that phenotypic features are annotated to genetic variations in different clinical and model organism databases For example, ZFIN typically annotates phenotypes to effective genotypes, MGI to intrinsic genotypes, Wormbase to variant alleles, and ClinVar to haplotypes and sequence alterations. The ability to decompose a genotype into representations at these levels allows us to \"propagate phenotypes\" up or down the partonomy (e.g. infer associations of phenotypes annotated to a genotype to its more granular levels of variation and the gene(s) affected). This helps to supporting integrated analysis of G2P data.""" ; rdfs:label "genotype"@en ; rdfs:subClassOf obo:IAO_0000030, [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:GENO_0000660 obo:GENO_0000715 ) ] ] . obo:GENO_0000575 a owl:Class ; rdfs:comment """ZFIN do not annotate with a pre-composed phenotype ontology - all annotations compose phenotypes on-the-fly using a combination of PATO, ZFA, GO and other ontologies. So while there is no manually curated zebrafish phenotype ontology, the Upheno pipeline generates one automatically here: http://purl.obolibrary.org/obo/upheno/zp.owl This ontology does not have a root 'phenotype' class, however, and so we generate our own in GENO as a stub placeholder for import of needed zebrafish phenotype classes.""" ; rdfs:label "zebrafish phenotype" ; rdfs:subClassOf obo:UPHENO_0001001 . obo:GENO_0000580 obo:IAO_0000115 "A relation used to describe a context or conditions that define and/or identify an entity." ; obo:IAO_0000116 """Used in Monarch Data to link associations to qualifying contexts (e.g. environments or developmental stages) where the association applies. For example, a qualifying environment represents a context where genotype-phenotype associations apply - where the environment is an identity criteria for the association. Used in GENO to describe physical context of materialized sequence features that represent identifying criteria for instances of qualified sequence features.""" ; obo:IAO_0000118 "has_qualifying_context" ; a owl:ObjectProperty ; rdfs:label "has_qualifier" . obo:GENO_0000602 obo:IAO_0000115 "an allelic state where a single allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism." ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "homoplasmic"@en ; rdfs:subClassOf obo:GENO_0000918 . obo:GENO_0000603 obo:IAO_0000115 "an allelic state where more than one type of allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism." ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "heteroplasmic"@en ; rdfs:subClassOf obo:GENO_0000918 . obo:GENO_0000604 oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "hemizygous X-linked"@en ; rdfs:subClassOf obo:GENO_0000134 . obo:GENO_0000605 oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "hemizygous Y-linked"@en ; rdfs:subClassOf obo:GENO_0000134 . obo:GENO_0000606 oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "hemizygous insertion-linked"@en ; rdfs:subClassOf obo:GENO_0000134 . obo:GENO_0000608 obo:IAO_0000115 "a relation to link a single locus complement to its zygosity." ; a owl:ObjectProperty ; rdfs:domain obo:GENO_0000516 ; rdfs:label "has_zygosity"@en ; rdfs:range obo:GENO_0000133 ; rdfs:subPropertyOf obo:GENO_0000207 . obo:GENO_0000610 obo:IAO_0000115 "A relationship between a reference locus/allele and the gene class it is an allele of." ; a owl:ObjectProperty ; rdfs:domain obo:GENO_0000036 ; rdfs:label "is_reference_allele_of"@en ; rdfs:subPropertyOf obo:GENO_0000408 . obo:GENO_0000611 obo:IAO_0000115 "A genomic genotype that specifies the baseline sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations)." ; obo:IAO_0000116 "Being a 'genomic background' implies that a variant genotype was derived from this background (which is the case for most model organism database genotypes/strains). This is a subtly different notion than being a 'reference genotype' , which can be any genotype that serves as a basis for comparison. But in a sense all background genotypes are by default reference genotypes, in that the derived variant genotype is compared against it." ; obo:IAO_0000118 "background genotype" ; a owl:Class ; rdfs:label "genomic background"@en ; rdfs:subClassOf obo:GENO_0000899, [ a owl:Restriction ; owl:onProperty obo:GENO_0000968 ; owl:someValuesFrom obo:GENO_0000152 ], [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom obo:GENO_0000010 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000899 [ a owl:Restriction ; owl:onProperty obo:GENO_0000968 ; owl:someValuesFrom obo:GENO_0000152 ] ) ] . obo:GENO_0000614 obo:IAO_0000112 "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." ; obo:IAO_0000115 "An extended part of a chromosome representing a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome > arm > region > band > sub-band." ; obo:IAO_0000116 "New term request for SO." ; obo:IAO_0000119 """http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome > arm > region > band > sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome > arm > band > sub-band > sub-sub-band""" ; a owl:Class ; rdfs:label "chromosomal region"@en ; rdfs:subClassOf obo:SO_0000830, [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:SO_0000105 ] . obo:GENO_0000616 obo:IAO_0000112 "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." ; obo:IAO_0000119 """http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome > arm > region > band > sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome > arm > band > sub-band > sub-sub-band""" ; a owl:Class ; rdfs:label "chromosome sub-band"@en ; rdfs:subClassOf obo:SO_0000830, [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:SO_0000341 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000618 ] . obo:GENO_0000618 obo:IAO_0000118 "chromosomal band brightness" ; a owl:Class ; rdfs:label "chromosomal band intensity"@en ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000619 a owl:Class ; rdfs:label "gpos"@en ; rdfs:subClassOf obo:GENO_0000618 . obo:GENO_0000620 a owl:Class ; rdfs:label "gneg"@en ; rdfs:subClassOf obo:GENO_0000618 . obo:GENO_0000621 a owl:Class ; rdfs:label "gvar"@en ; rdfs:subClassOf obo:GENO_0000618 . obo:GENO_0000622 a owl:Class ; rdfs:label "gpos100"@en ; rdfs:subClassOf obo:GENO_0000619 . obo:GENO_0000623 a owl:Class ; rdfs:label "gpos75"@en ; rdfs:subClassOf obo:GENO_0000619 . obo:GENO_0000624 a owl:Class ; rdfs:label "gpos50"@en ; rdfs:subClassOf obo:GENO_0000619 . obo:GENO_0000625 a owl:Class ; rdfs:label "gpos25"@en ; rdfs:subClassOf obo:GENO_0000619 . obo:GENO_0000626 obo:IAO_0000116 "Consider obsoleting - it is likely sufficeint to use the parent has_sequence_attribute property - a separate proeprty to link to the staining intensity attribute is not really needed." ; obo:IAO_0000118 "has_color_value"@en ; a owl:ObjectProperty ; rdfs:comment "Used to link a gross chromosomal sequence feature (chromosome part) to a color value quality that inheres in the sequence feature in virtue of the staining pattern of the chromosomal DNA in which the sequence is materialized." ; rdfs:label "has_staining_intensity" ; rdfs:subPropertyOf obo:GENO_0000207 . obo:GENO_0000628 obo:IAO_0000115 "A chromosome arm that is the shorter of the two arms of a given chromosome." ; obo:IAO_0000118 "p-arm", "stalk" ; a owl:Class ; rdfs:label "short chromosome arm"@en ; rdfs:subClassOf obo:SO_0000105 . obo:GENO_0000629 obo:IAO_0000115 "A chromosome arm that is the longer of the two arms of a given chromosome." ; obo:IAO_0000118 "q-arm" ; a owl:Class ; rdfs:label "long chromosome arm"@en ; rdfs:subClassOf obo:SO_0000105 . obo:GENO_0000632 a owl:Class ; rdfs:label "gpos66" ; rdfs:subClassOf obo:GENO_0000619 . obo:GENO_0000633 a owl:Class ; rdfs:label "gpos33" ; rdfs:subClassOf obo:GENO_0000619 . obo:GENO_0000634 obo:IAO_0000112 "Used to link a gene targeting reagent such as a morpholino, to an instance of a reagent targeted gene variant." ; obo:IAO_0000115 "relation between an molecular agent and its molecular target" ; a owl:ObjectProperty ; rdfs:label "is_targeted_by"@en . obo:GENO_0000637 obo:IAO_0000115 "A transgene part whose sequence regulates the synthesis of a functional product, but which is not itself transcribed." ; a owl:Class ; rdfs:label "regulatory transgene region"@en ; rdfs:subClassOf obo:GENO_0000460, obo:SO_0005836 . obo:GENO_0000638 obo:IAO_0000115 "A transgene part whose sequence is expressed in a gene product through transcription and/or translation." ; obo:IAO_0000118 "coding transgene feature" ; a owl:Class ; rdfs:label "expressed transgene region"@en ; rdfs:subClassOf obo:GENO_0000460 . obo:GENO_0000639 obo:IAO_0000112 """1. Used to specify derivation of transgene components from a gene class, or a engineered construct instance. 2. Used to specify the genetic background/strain of origin of an allele (i.e. that an allele was originally isolated from a specific background strain, and propagated into new genetic backgrounds. 3. Used to indicate derivation of a variant mouse genotype from an ES cell line used in generating the modified mice (IMPC)""" ; obo:IAO_0000115 "Relationship between a sequence feature and a distinct, non-overlapping feature from which it derives part or all of its sequence." ; a owl:ObjectProperty ; rdfs:label "sequence_derives_from"@en ; rdfs:subPropertyOf owl:topObjectProperty ; owl:propertyChainAxiom (obo:BFO_0000051 obo:GENO_0000639 ) . obo:GENO_0000640 a owl:Class ; rdfs:label "reporter region"@en ; rdfs:subClassOf obo:GENO_0000638 . obo:GENO_0000641 obo:IAO_0000115 "A relationship between a variant allele and the gene class it is an allele of." ; a owl:ObjectProperty ; rdfs:domain obo:GENO_0000002 ; rdfs:label "is_variant_allele_of"@en ; rdfs:subPropertyOf obo:GENO_0000408 . obo:GENO_0000642 obo:IAO_0000115 "A transgene whose product is used as a selectable marker." ; a owl:Class ; rdfs:label "selectable marker transgene"@en ; rdfs:subClassOf obo:SO_0000804, obo:SO_0000902, [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000911 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0000902 [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000911 ] ) ] . obo:GENO_0000644 obo:IAO_0000115 "A genotype that describes what is known about variation in a genome at a gross structural level, in terms of the number and appearance of chromosomes in the nucleus of a eukaryotic cell." ; obo:IAO_0000119 "Derived from http://en.wikipedia.org/wiki/Karyotype (accessed 2017-03-28)" ; a owl:Class ; rdfs:comment """Karyotypes describe structural variation across a genome at the level of chromosomal morphology and banding patterns detectable in stained chromosomal spreads. This coarser level does not capture more granular levels of variation commonly represented in other forms of genotypes (e.g. specific alleles and sequence alterations). A base karyotype representing a genome with no known structural variation can be as simple as '46XY', but karyotypes typically contains some gross variant component (such as a chromosome duplication or translocation).""" ; rdfs:label "karyotype"@en ; rdfs:subClassOf obo:GENO_0000899 . obo:GENO_0000645 obo:IAO_0000115 "A genomic genotype where the genomic background specifies a male or female sex chromosome complement." ; obo:IAO_0000116 """This modeling approach enables creation separate genotype instances for data sources that report sex-specific phenotypes to ensure that sex-specific G2P differences are accurately described. These sex specific genotypes can be linked to the broader intrinsic genotype that is shared by male and female mice of the same strain, to aggregate associated phenotypes at this level, and allow aggregation with G2P association data about the same strains from sources that distinguish sex-specific phenotypes (e.g. IMPC) and those that do not (e.g. MGI). In the genotype partonomy, a sex qualified genotype has as part a sex-agnostic genotype. This allows for the propagation of phenotypes associated with a sex-qualified genotype to the intrinsic genotype. Ontologically, this parthood is based on the fact that the background component of a sex-qualified genotype specifies the sex chromosomes while that of the sex-agnostic genotype does not. Thus, the sequence content of the sex-qualified genotype is a superset of that of the intrinsic genotype, with the latter being a proper part of the former.""" ; obo:IAO_0000118 "intrinsic genotype (sex-specific)", "sex-qualified genotype", "sex-qualified intrinsic genotype" ; a owl:Class ; rdfs:comment """We distinguish the notion of a sex-agnostic intrinsic genotype, which does not specify whether the portion of the genome defining organismal sex is male or female, from the notion of a sex-qualified intrinsic genotype, which does. Male and female mice that contain the same background and genetic variation complement will have the same 'sex-agnostic intrinsic genotype', despite their genomes varying in their sex-chromosome complement. By contrast, these two mice would have different 'sex-qualified intrinsic genotypes', as this class takes background sex chromosome sequences into account in the identity criteria for its instances. Conceptually, a sex-qualified phenotype represents a superset of sequence features relative to a sex-agnostic intirnsic genotype, in that if specifies the background sex-chromosome complement of the genome.""" ; rdfs:label "genomic genotype (sex-qualified)"@en ; rdfs:subClassOf obo:GENO_0000899, [ a owl:Restriction ; owl:onProperty obo:GENO_0000650 ; owl:someValuesFrom obo:GENO_0000000 ] . obo:GENO_0000646 obo:IAO_0000115 "A genomic genotype here the genomic background specifies a male sex chromosome complement." ; a owl:Class ; rdfs:label "male intrinsic genotype"@en ; rdfs:subClassOf obo:GENO_0000645 . obo:GENO_0000647 obo:IAO_0000115 "A genomic genotype here the genomic background specifies a female sex chromosome complement." ; a owl:Class ; rdfs:label "female intrinsic genotype"@en ; rdfs:subClassOf obo:GENO_0000645 . obo:GENO_0000649 obo:IAO_0000115 "A background genotype whose sequence or identity is not known or specified." ; obo:IAO_0000118 "unspecified background genotype" ; a owl:Class ; rdfs:label "unspecified genomic background"@en ; rdfs:subClassOf obo:GENO_0000611 . obo:GENO_0000650 obo:IAO_0000116 "Relationship between a sex-qualified genotype and intrinsic genotype, created specifically to support propagation of phenotypes asserted on the former to the later for Monarch Initiative use cases." ; a owl:ObjectProperty ; rdfs:label "has_sex_agnostic_part"@en ; rdfs:subPropertyOf obo:GENO_0000654 ; owl:inverseOf obo:GENO_0000661 . obo:GENO_0000651 a owl:ObjectProperty ; rdfs:comment "A relation between a mutant allele (ie rare variant present in less than 1% of a population, or an experimentally-altered variant such as a knocked-out gene in a model organism), and the gene it is a variant of." ; rdfs:domain obo:GENO_0000491 ; rdfs:label "is_mutant_allele_of"@en ; rdfs:subPropertyOf obo:GENO_0000641 . obo:GENO_0000652 obo:IAO_0000115 "A relationship between a polymorphic allele and the gene class it is an allele of." ; a owl:ObjectProperty ; rdfs:domain obo:GENO_0000497 ; rdfs:label "is_polymorphic_allele_of"@en ; rdfs:subPropertyOf obo:GENO_0000641 . obo:GENO_0000653 obo:IAO_0000115 "A relationship between a wild-type allele and the gene class it is an allele of." ; a owl:ObjectProperty ; rdfs:domain obo:GENO_0000501 ; rdfs:label "is_wild_type_allele_of"@en ; rdfs:subPropertyOf obo:GENO_0000408 . obo:GENO_0000654 obo:IAO_0000115 "An organizational class to hold relations of parthood between sequences/features." ; a owl:ObjectProperty ; rdfs:label "has_sequence_part"@en ; rdfs:subPropertyOf obo:BFO_0000051 ; owl:inverseOf obo:GENO_0000655 . obo:GENO_0000655 a owl:ObjectProperty ; rdfs:label "is_sequence_part_of"@en ; rdfs:subPropertyOf obo:BFO_0000050 . obo:GENO_0000659 obo:IAO_0000112 """1. The set of all alleles at a particular location in a genome (a 'single locus complement') - e.g. {APOE-epsilon2 / APOE-epsilon4} at the APOE locus 2. The set of all alleles that comprise a haplotype - e.g. the SNPs {rs7412-T, rs429358-T} in the APOEɛ2 allele. 3. The set of all chromosomes in a genome - e.g. {human Chr1, 2, 3, . . . 22, X, Y}""" ; obo:IAO_0000115 "A set of sequence features." ; a owl:Class ; rdfs:comment """'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. Sets may also include duplicates (i.e. contain more than one member representing the same feature). The notion of a 'complement' is a special case of a set, where the members necessarily comprise an exhaustive collection of all objects that make up some well-defined set. It is useful for defining many biologically-relevant sets of sequence features. For example, a 'haplotype' is the set of all genetically-linked alleles on a single chromosomal strand at a defined location - e.g. the SNP alleles {rs7412-C, rs429358-C} comprise the haplotype defining the APOEɛ4 gene allele [1]. And a 'single locus complement' is the set of all alleles at a specified location in a particular genome - e.g. the APOEɛ4 and APOEɛ4 gene alleles ([1], [2]) that make up the 'Gs270' APOE genotype [3]. [1] https://www.snpedia.com/index.php/APOE-%CE%B54 [2] https://www.snpedia.com/index.php/APOE-%CE%B52 [3] https://www.snpedia.com/index.php/Gs270""" ; rdfs:label "sequence feature set"@en ; rdfs:subClassOf obo:GENO_0000701, [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:SO_0000110 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000917 ; owl:someValuesFrom xsd:int ] . obo:GENO_0000660 obo:IAO_0000115 "A set of genomic features (i.e. sequence features that are of genomic origin)." ; obo:IAO_0000116 "In some cases there may be zero or only one member of such a complement, which is why this class is not defened to necessarily have some 'genomic feature' as a member." ; obo:IAO_0000118 "genomic locus complement" ; a owl:Class ; rdfs:comment """A genomic feature is any located sequence feature in the genome, from a single nucleotide to a gene into an entire chromosome. 'Sets' are used to represent entities that are typically collections of more than one member - e.g. the set of chromosomes that make up the human genome. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. For example, a 'single locus complement' at an X-linked locus in a XY male will consist of only one allele, as there is only one X-chromosome in the genome. Note also that sets may contain duplicates (i.e. more than one member representing the same feature). For example, a homozygous 'single locus complement' is a set comprised of two of the same feature. The notion of a 'genomic feature set' differs from that of a 'genomic sequence set' in that we are counting how many copies of the same *sequence feature* exist in a genome, as opposed to how many of the same *sequence*. 'Genomic feature sets are useful for representing things like 'single locus complements', where members are sequence features whose identity is dependent on their location. By contrast, 'genomic sequence sets' are useful for describing things like 'copy number complements', which are concerned only with how many copies of a sequence exist in a genome, regardless of the location where these reside.""" ; rdfs:label "genomic feature set"@en ; rdfs:subClassOf obo:GENO_0000659, obo:GENO_0000897, [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:GENO_0000481 ] . obo:GENO_0000661 obo:IAO_0000115 "Relationship between an intrinsic genotype and a sex-qualified genotype, created specifically to support propagation of phenotypes asserted on the latter to the former for Monarch Initiative use cases." ; a owl:ObjectProperty ; rdfs:label "is_sex_agnostic_part_of"@en ; rdfs:subPropertyOf obo:GENO_0000655 . obo:GENO_0000666 obo:IAO_0000115 "A genomic feature that is part of a gene, and delineated by some functional or structural function or role it serves (e.g.a promoter element, coding region, etc)." ; obo:IAO_0000118 "defined gene part" ; oboInOwl:hasDbXref "SO:0000831 (gene member region)" ; a owl:Class ; rdfs:label "gene part" ; rdfs:subClassOf obo:GENO_0000481, obo:RO_0002532, [ a owl:Restriction ; owl:onProperty obo:RO_0002525 ; owl:someValuesFrom obo:GENO_0000014 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000481 [ a owl:Restriction ; owl:onProperty obo:RO_0002525 ; owl:someValuesFrom obo:GENO_0000014 ] ) ] . obo:GENO_0000667 obo:IAO_0000115 "A transgene that codes for a product used as a reporter of gene expression or activity." ; a owl:Class ; rdfs:label "reporter transgene"@en ; rdfs:subClassOf obo:SO_0000804, obo:SO_0000902, [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:GENO_0000640 ], _:genid553 ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0000902 [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000910 ] ) ] . obo:GENO_0000678 obo:IAO_0000115 "Property linking a sequence or sequence feature to an integer representing its length in terms of the number of units in the sequence." ; a owl:DatatypeProperty ; rdfs:label "has_extent"@en ; rdfs:range xsd:int . obo:GENO_0000680 obo:IAO_0000112 "A junction between bases, a deletion variant, a terminus at the end of a chromosome." ; obo:IAO_0000115 "A genomic feature that has an extent of zero." ; obo:IAO_0000116 """Former logical def: 'genomic feature' and (has_extent value 0)""" ; a owl:Class ; rdfs:label "obsolete null feature" ; owl:deprecated true . obo:GENO_0000681 obo:IAO_0000115 "An extrachromosomal replicon that is variant in a genome in virtue of its being a novel addition to the genome - i.e. it is not present in the reference for the genome in which it is found." ; obo:IAO_0000118 "aberrant extrachromosomal replicon", "exogenous extrachromosomal replicon", "transgenic extrachromosomal replicon"@en ; a owl:Class ; rdfs:comment "Extrachromosomal replicons are replicated and passed on to descendents, and thus part of the heritable genome of a cell or organism. In cases where the presence of such a replicon is exogenous or aberrant (i.e. not included in the reference for that genome), the replicon is considered a 'sequence alteration'." ; rdfs:label "novel extrachromosomal replicon" ; rdfs:subClassOf obo:GENO_0000494, obo:GENO_0000684, [ a owl:Class ; owl:complementOf _:genid555 ] . obo:GENO_0000683 obo:IAO_0000115 "A relation that holds between two sequence features at a particular genomic location that vary in their sequence. These features will have the same position when mapped onto a reference sequence, but vary in their sequence (in whole or in part)." ; a owl:ObjectProperty, owl:SymmetricProperty ; rdfs:comment "This property is most commonly used to relate two different alleles of a given gene (e.g. a wt and mutant instance of the BRCA2 gene). It is not a relation between an allele and the class-level gene it is a variant of (for this use is_allele_of)" ; rdfs:label "varies_with"@en . obo:GENO_0000684 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A genomic feature that represents an entirely new replicon in the genome, e.g. an extrachromosomal replicon or an extra copy of a chromosome." ; obo:IAO_0000116 "This class is defined so as to support classification of things like novel extrachromosomal replicons and aneusomic chromosomes as being variant alleles in a genome. These represent entirely new features in the genome - not variants of an existing feature." ; a owl:Class ; rdfs:comment "Novel replicons are considered as an 'insertion' in a genome, and as such, qualify as types of sequence_alterations and variant alleles. There is no pre-existing locus that it modifies, however, and thus it is not really an 'allele of' a named locus. But conceptually, we still consider these to represent genetic variants and classify them as variant alleles." ; rdfs:label "novel replicon"@en ; rdfs:subClassOf obo:SO_0001059, [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000685 ] . obo:GENO_0000685 obo:IAO_0000115 "An attribute of a genomic feature that represents a feature not previously found in a given genome, e.g. an extrachromosomal replicon or aneusomic third copy of a chromosome." ; a owl:Class ; rdfs:label "novel"@en ; rdfs:subClassOf obo:GENO_0000773 . obo:GENO_0000688 obo:IAO_0000115 "A sequence feature representing the end of a sequence that is bounded only on one side (e.g. at the end of an chromosome or oligonucleotide)." ; a owl:Class ; rdfs:label "terminus"@en ; rdfs:subClassOf obo:SO_0000110 . obo:GENO_0000701 obo:IAO_0000115 "A sequence feature or a set of such features." ; obo:IAO_0000118 "sequence feature or collection" ; a owl:Class ; rdfs:comment """GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location.""" ; rdfs:label "sequence feature or set"@en ; rdfs:subClassOf obo:BFO_0000031 ; owl:equivalentClass [ a owl:Class ; owl:unionOf (obo:GENO_0000701 obo:SO_0000110 ) ] . obo:GENO_0000702 obo:IAO_0000115 "A linear ordering of units representing monomers of a biological macromolecule (e.g. nucleotides in DNA and RNA, amino acids in polypeptides)." ; obo:IAO_0000116 """GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern).""" ; obo:IAO_0000118 "biomacromolecular sequence", "state" ; oboInOwl:hasDbXref "VMC:State" ; a owl:Class ; rdfs:comment "'Sequences' differ from 'sequence features' in that instances are distinguished only by their inherent ordering of units, and not by any positional aspect related to alignment with some reference sequence. Accordingly, the 'ATG' translational start codon of the human AKT gene is the same *sequence* as the 'ATG' start codon of the human SHH gene, but these represent two distinct *sequence features* in virtue of their different positions in the genome." ; rdfs:label "biological sequence"@en ; rdfs:subClassOf obo:GENO_0000921, _:genid505 ; owl:disjointWith obo:GENO_0000815, obo:SO_0000110 . obo:GENO_0000703 obo:IAO_0000115 "Shortcut relation linking a sequence feature directly to a string representing the 'state' of its sequence - i.e. the ordering of units that comprise it (e.g. 'atgcagctagctaccgtcgatcg')." ; a owl:DatatypeProperty ; rdfs:domain obo:SO_0000110 ; rdfs:label "has_sequence_string"@en ; rdfs:range xsd:string . obo:GENO_0000708 a owl:ObjectProperty ; rdfs:comment "organizational property to hold imports from faldo." ; rdfs:label "faldo properties"@en . obo:GENO_0000712 a owl:DatatypeProperty ; rdfs:label "ObsoleteDataProperty"@en ; owl:deprecated true . obo:GENO_0000713 obo:IAO_0000115 "A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." ; a owl:Class ; rdfs:label "qualified sequence feature or collection"@en ; rdfs:subClassOf obo:BFO_0000031 . obo:GENO_0000714 obo:IAO_0000112 "Consider wild-type zebrafish shha gene in the context of being targeted by morpholino MO-1 vs morpholino MO-2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'qualified sequence feature' because of their different external contexts. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants (alleles) of the same gene can have potentially different associated phenotypes)." ; obo:IAO_0000115 "A qualified sequence feature that carries sequence derived from the genome of a cell or organism." ; a owl:Class ; rdfs:label "qualified genomic feature"@en ; rdfs:subClassOf obo:GENO_0000897, obo:GENO_0000919, _:genid508, _:genid510 . obo:GENO_0000715 obo:IAO_0000115 "A set of qualified sequence features that carry genomic sequence." ; obo:IAO_0000116 "Because there are cases there may be zero or only one member of such a set, this class is not asserted to necessarily have some 'qualified genomic feature' as a member." ; a owl:Class ; rdfs:comment """A 'complement' refers to an exhaustive collection of all objects that make up some well-defined set. This notion is useful for defining biologically-relevant sets of sequence features. For example, a haplotype is defined as the set of all genetically-linked alleles on a single chromosomal strand at a defined location - e.g. the SNP alleles {rs7412-C, rs429358-C} comprise the haplotype defining the APOEɛ4 gene allele. A complements may contain 0, 1, or more than one members. For example, the complement of alleles at a defined locus across homologous chromosomes in an individual's genome will consist of two members for autosomal locations, and one member for non-homologous locations on the X and Y chromosome.""" ; rdfs:label "qualified genomic feature set"@en ; rdfs:subClassOf obo:GENO_0000897, obo:GENO_0000920, [ a owl:Restriction ; owl:onProperty obo:GENO_0000726 ; owl:someValuesFrom obo:GENO_0000660 ], _:genid565 . obo:GENO_0000719 obo:IAO_0000116 "Genotype vs Genome in GENO: An (intrinsic) genotype is an information artifact representing an indirect syntax for specifying a genome sequence. This syntax has reference and variant components - a 'background genotype' and 'genomic variation complement' - that must be operated on to resolve a specifie genome sequence. Specifically, the genome sequence is resolved by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the 'reference genome'. So, while the total sequence content represented in a genotype may be greater than that in a genome, the intended resolution of these sequences is to arrive at a single genome sequence. It is this end-point that we consider when holding that a genotype 'specifies' a genome." ; a owl:Class ; rdfs:comment """1. A genomic genotype is a short-hand specification of a genome that uses a representational syntax comprised of information about a reference genome ('genomic background'), and all specific variants from this reference (the 'genomic variation complement'). Conceptually, this variant genome sequence can be resolved by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the reference 'genomic background' sequence. 2. 'Heritable' genomic sequence is that which is passed on to subsequent generations of cells/organisms, and includes all chromosomal sequences, the mitochondrial genome, and any transmissable extrachromosomal replicons.""" ; rdfs:label "intrinsic genotype"@en ; rdfs:subClassOf obo:GENO_0000536, [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom _:genid567 ] . obo:GENO_0000720 a owl:Class ; rdfs:label "DNA sequence"@en ; rdfs:subClassOf obo:GENO_0000702, [ a owl:Restriction ; owl:onProperty obo:GENO_0000783 ; owl:someValuesFrom obo:GENO_0000780 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000702 [ a owl:Restriction ; owl:onProperty obo:GENO_0000783 ; owl:someValuesFrom obo:GENO_0000780 ] [ a owl:Restriction ; owl:allValuesFrom obo:GENO_0000780 ; owl:onProperty obo:GENO_0000783 ] ) ] . obo:GENO_0000721 a owl:Class ; rdfs:label "RNA sequence"@en ; rdfs:subClassOf obo:GENO_0000702, [ a owl:Restriction ; owl:onProperty obo:GENO_0000783 ; owl:someValuesFrom obo:GENO_0000781 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000702 [ a owl:Restriction ; owl:onProperty obo:GENO_0000783 ; owl:someValuesFrom obo:GENO_0000781 ] [ a owl:Restriction ; owl:allValuesFrom obo:GENO_0000781 ; owl:onProperty obo:GENO_0000783 ] ) ] . obo:GENO_0000722 a owl:Class ; rdfs:label "amino acid sequence"@en ; rdfs:subClassOf obo:GENO_0000702, [ a owl:Restriction ; owl:onProperty obo:GENO_0000783 ; owl:someValuesFrom obo:GENO_0000782 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000702 [ a owl:Restriction ; owl:onProperty obo:GENO_0000783 ; owl:someValuesFrom obo:GENO_0000782 ] [ a owl:Restriction ; owl:allValuesFrom obo:GENO_0000782 ; owl:onProperty obo:GENO_0000783 ] ) ] . obo:GENO_0000724 a owl:Class ; rdfs:label "obsolete biological sequence or collection" ; owl:deprecated true . obo:GENO_0000725 a owl:Class ; rdfs:label "obsolete biological sequence collection" ; owl:deprecated true . obo:GENO_0000726 obo:IAO_0000115 "A relation linking a qualified sequence feature to its component sequence feature." ; obo:IAO_0000118 "has_sequence_feature_component" ; a owl:ObjectProperty ; rdfs:comment "In GENO we define three levels of sequence artifacts: (1) biological sequences, (2) sequence features, and (3) qualified sequence features. The identify criteria for a 'biological sequence' include only its inherent sequence (the ordered string of units that comprise it). The identity criteria for a 'sequence feature' include its sequence and position (where it resides - i.e. its location based on how it maps to a reference or standard) The identity criteria for a 'qualified sequence feature' include its component sequence feature (defined by its sequence and position), and the material context of its bearer in a cell or organism. This context can include direct epigenetic modification, or being targeted by gene knockdown reagents such as morpholinos or RNAi, or being transiently overexpressed from a transgenic construct in a cell or organism." ; rdfs:domain [ a owl:Class ; owl:unionOf (obo:GENO_0000919 obo:GENO_0000920 ) ] ; rdfs:label "has_sequence_feature"@en ; rdfs:range obo:SO_0000110 . obo:GENO_0000736 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A sequence feature whose identity is additionally dependent on the cellular or anatomical location of the genetic material bearing the feature." ; a owl:Class ; rdfs:comment "As a qualified sequence feature, the BRCA1c.5096G>A variant as materialized in a somatic breast epithelial cell could be distinguished as a separate entity from a BRCA1c.5096G>A variant in a different cell type or location (e.g. germline BRCA1 varaint in a sperm cell)." ; rdfs:label "location-qualified sequence feature"@en ; rdfs:subClassOf obo:GENO_0000714 . obo:GENO_0000737 obo:IAO_0000115 "A sequence feature whose identity is additionally dependent on factors specifically influencing its level of expression in the context of a biological system (e.g. being targeted by gene-knockdown reagents, or driven from exogneous expression system like recombinant construct)" ; a owl:Class ; rdfs:label "expression-qualified sequence feature"@en ; rdfs:subClassOf obo:GENO_0000714 . obo:GENO_0000740 a owl:ObjectProperty ; rdfs:label "has_inferred_phenotype"@en ; owl:propertyChainAxiom (obo:GENO_0000382 obo:GENO_0000743 ), (obo:GENO_0000383 obo:GENO_0000661 obo:GENO_0000743 ), (obo:GENO_0000383 obo:GENO_0000743 ), (obo:GENO_0000413 obo:GENO_0000383 obo:GENO_0000743 ), (obo:GENO_0000413 obo:GENO_0000743 ), (obo:GENO_0000449 obo:GENO_0000383 obo:GENO_0000743 ), (obo:GENO_0000449 obo:GENO_0000743 ), (obo:GENO_0000661 obo:GENO_0000743 ) . obo:GENO_0000741 a owl:ObjectProperty ; rdfs:comment "Proposal for a property linking variants to smaller components that are regulatory, and therefore should not inherit phenotypes." ; rdfs:label "obsolete_has_regulatory_part"@en ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000742 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A relation linking a sequence_alteration to the gene it alters." ; obo:IAO_0000118 "is_within_allele_of" ; a owl:ObjectProperty ; rdfs:label "obsolete_is_alteration_within"@en ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true ; owl:propertyChainAxiom (obo:GENO_0000383 obo:GENO_0000408 ) . obo:GENO_0000743 a owl:ObjectProperty ; rdfs:label "has_asserted_phenotype"@en ; rdfs:subPropertyOf obo:RO_0002200 . obo:GENO_0000761 obo:IAO_0000116 "Proposal for a property linking regulatory elements to larger features of which they are a part." ; a owl:ObjectProperty ; rdfs:label "is_regulatory_part_of"@en ; rdfs:subPropertyOf obo:GENO_0000655 . obo:GENO_0000767 obo:IAO_0000115 "A relation linking a sequence feature to its component Position that represents an identifying criteria for sequence feature instances." ; obo:IAO_0000116 "For representing positional data, we advocate use of the FALDO model, which links to positional information through an instance of a Region class that represents the mapping of the feature onto some reference sequence. The positional_component property in GENO is meant primarily to formalize the identity criteria or sequence features and qualified sequence features, to illustrate the distinction between them." ; a owl:ObjectProperty ; rdfs:label "obsolete_has_position_component"@en ; rdfs:subPropertyOf oboInOwl:ObsoleteProperty ; owl:deprecated true . obo:GENO_0000768 obo:IAO_0000115 "A sequence feature position based on a genomic coordinate system, where the position specifies start and end coordinates based on its alignment with some reference genomic sequence." ; obo:IAO_0000116 "This 'genomic position' concept differs from the faldo:Position concecpt in that the former describes the start AND end points/coordinates of a feature, while the latter describes a single point/coordinate at the beginning OR end of a feature." ; obo:IAO_0000118 "genomic coordinates"@en ; obo:IAO_0000231 "remodeling notion of sequence feature position around the idea of a 'genomic locus'" ; a owl:Class ; rdfs:label "obsolete genomic position" ; owl:deprecated true . obo:GENO_0000770 obo:IAO_0000114 obo:GENO_0000484 ; a owl:Class ; rdfs:label "phenotypic inheritance process"@en ; rdfs:subClassOf obo:GENO_0000351 . obo:GENO_0000772 obo:IAO_0000115 "A sequence attribute inhering in a feature whose identity is not specified." ; a owl:Class ; rdfs:label "obsolete unspecified" ; owl:deprecated true . obo:GENO_0000773 obo:IAO_0000115 "An attribute describing a type of variation inhering in a sequence feature or collection." ; obo:IAO_0000118 "allele attribute" ; a owl:Class ; rdfs:label "variation attribute"@en ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000777 obo:IAO_0000115 "An intrinsic genotype that specifies variation from a defined reference genome." ; a owl:Class ; rdfs:label "variant genomic genotype"@en ; rdfs:subClassOf obo:GENO_0000899, [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom obo:GENO_0000033 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000899 [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom obo:GENO_0000033 ] ) ] . obo:GENO_0000778 obo:IAO_0000115 "An information entity that is intented to represent some biological sequence, sequence feature, qualified sequence feature, or a collection of one or more of these entities." ; obo:IAO_0000231 "eliminating classes that are not necessary or add uneeded complexity." ; a owl:Class ; rdfs:label "obsolete sequence information entity" ; owl:deprecated true . obo:GENO_0000779 obo:IAO_0000118 "biological sequence residue", "monomeric residue" ; a owl:Class ; rdfs:label "biological sequence unit"@en ; rdfs:subClassOf obo:GENO_0000702 ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000702 [ a owl:Restriction ; owl:hasValue 1 ; owl:onProperty obo:GENO_0000678 ] ) ] . obo:GENO_0000780 obo:IAO_0000118 "deoxyribonucleic acid residue" ; a owl:Class ; rdfs:label "DNA residue"@en ; rdfs:subClassOf obo:GENO_0000779 . obo:GENO_0000781 obo:IAO_0000118 "ribonucleic acid residue" ; a owl:Class ; rdfs:label "RNA residue"@en ; rdfs:subClassOf obo:GENO_0000779 . obo:GENO_0000782 a owl:Class ; rdfs:label "amino acid residue"@en ; rdfs:subClassOf obo:GENO_0000779 . obo:GENO_0000783 obo:IAO_0000115 "A relation between a nucleic acid or amino acid sequence or sequence feature, and one of its monomeric units (nucleotide or amino acid residues)" ; a owl:ObjectProperty ; rdfs:label "has_sequence_unit"@en ; rdfs:subPropertyOf obo:GENO_0000654 . obo:GENO_0000784 obo:IAO_0000115 "A relation between two seqeunces or features that are considered variant with each other along their entire extents." ; a owl:ObjectProperty, owl:SymmetricProperty ; rdfs:label "completely_varies_with"@en ; rdfs:subPropertyOf obo:GENO_0000683 . obo:GENO_0000788 obo:IAO_0000115 "An attribute, quality, or state of a sequence feature or collection." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/SO_0000400" ; a owl:Class ; rdfs:comment "Sequence feature attributes can be 'intrinsic' - reflecting feature-level characteristics that depend only on the sequence, location, or genomic context of a feature or collection, or 'extrinsic' - reflecting characteristics of the physical molecule in which the feature is concretized (e.g. its cellular context, source of origin, physical appearance, etc.). Intrinsic attributes include things like allelic state, allelic phase. Extrinsic attributes include things like its cellular distribution and chromosomal band intensity." ; rdfs:label "sequence feature attribute" ; rdfs:subClassOf obo:BFO_0000020 . obo:GENO_0000790 a owl:ObjectProperty ; rdfs:label "related_condition"@en . obo:GENO_0000791 obo:IAO_0000116 "Note that we currently do not have a property chain to propagate phenotypes to genes across sequence_derives_from relation (e.g. in cases where a Tg insertion derives expressed sequence from some gene)", """The property chains below are defined as explicitly as possible, but many could be shortened if we used the inferred_to_cause_condition property to construct the property chains. Where this is the case, it is noted in the annotations on the property chains. Below are the different kinds/paths of propagation we desire: 1. Propagation 'down' a genotype (from larger components to smaller ones) 2. Propagation 'up' a genotype (from smaller components to larger ones) 3. From sex-qualified genotypes down to the sex-agnostic genotype and its components (but not 'up' to a sex-qualified genotype). 4. From an effective genotype to its intrinsic and extrinsic components. 5. From genotype components to genes (note here that a separate chain is needed to propagate conditions asserted on a sequence alteration to the gene, because of the fact that the link to the gene is from the variant locus/allele). 6. (Exploratory). There are cases where we may also want inter-genotype propagation (i.e. propagation that extends beyond moving up or down a single genotype). For example, if a phenotype is asserted on a sex-qualified intrinsic genotype, we want it to infer down through its component sex-agnostic intrinsic genotype and then up to any effective genotypes of which this sex-agnostic intrinsic genotype is a part. Given the data in hand, however, the conditions for this will likely never occur, so probably ok not to implement a chain to support this. Note that we do not want to propagate phenotypes up from sex-agnostic genotyeps to sex-qualified ones (e.g.from shha/shha [AB] to shha/shha [AB](male)) - because it may not be the case that a phenotype assessed without consideratioon to sex will apply on a sex-specific background. So we would not create a property chain to propagate inferred condition associations from sex-agnaostic intrinsic genotypes and their parts to sex-qualified intrinsic genotypes and effective genotypes that contain them (such as: has_variant_part o has_sex_agnostic_part o has_variant_part o 'causes condition')""" ; a owl:ObjectProperty ; rdfs:label "inferred_to_cause_condition"@en ; rdfs:subPropertyOf obo:GENO_0000790 ; owl:propertyChainAxiom (obo:GENO_0000445 obo:GENO_0000383 obo:RO_0003303 ), (obo:GENO_0000445 obo:RO_0003303 ), (obo:GENO_0000661 obo:GENO_0000383 obo:RO_0003303 ), (obo:GENO_0000661 obo:RO_0003303 ), (obo:GENO_0000382 obo:GENO_0000661 obo:RO_0003303 ), (obo:GENO_0000382 obo:RO_0003303 ), (obo:GENO_0000383 obo:GENO_0000661 obo:GENO_0000383 obo:RO_0003303 ), (obo:GENO_0000383 obo:GENO_0000661 obo:RO_0003303 ), (obo:GENO_0000383 obo:RO_0003303 ), (obo:GENO_0000413 obo:GENO_0000383 obo:GENO_0000661 obo:GENO_0000383 obo:RO_0003303 ), (obo:GENO_0000413 obo:GENO_0000383 obo:GENO_0000661 obo:RO_0003303 ), (obo:GENO_0000445 obo:GENO_0000382 obo:RO_0003303 ) . obo:GENO_0000793 a owl:ObjectProperty ; rdfs:label "inferred_to_contribute_to_condition"@en ; rdfs:subPropertyOf obo:GENO_0000790 . obo:GENO_0000794 a owl:ObjectProperty ; rdfs:label "inferred_to_correlate_with_condition"@en ; rdfs:subPropertyOf obo:GENO_0000790 . obo:GENO_0000815 obo:IAO_0000115 "The location of a sequence feature as defined by its start and end position on some reference coordinate system." ; a owl:Class ; rdfs:comment """1. A sequence feature location is defined by its begin and end coordinates on a reference sequence, but it is not identified by a particular sequence that may reside there. The same location, as defined on a particular reference, may be occupied by different sequences in the genome of organism 1 vs that of organism 2 (e.g. if a SNV exists within this location in only one of the organisms). 2. The notion of a sequence feature location in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be 'occupied by' physical objects, while a genomic location is 'occupied by' sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a genomic location is distinct from a sequence feature that occupies it. As a more concrete example, consider the distinction between a street address and the building that occupies it as analogous to the relationship between a genomic locus and the sequence feature that resides there.""" ; rdfs:label "sequence feature location"@en ; rdfs:subClassOf obo:BFO_0000031 ; owl:disjointWith obo:SO_0000110 . obo:GENO_0000818 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A sequence feature whose identity is additionally dependent on a chemical modification made to the genetic material bearing the feature (e.g. binding of transcriptional regulators, or epigenetic modifications including direct DNA methylation, or modification of histones associated with a feature)" ; a owl:Class ; rdfs:label "modification-qualified sequence feature"@en ; rdfs:subClassOf obo:GENO_0000714 . obo:GENO_0000823 obo:IAO_0000112 """1. The zebrafish \"fgf8a/fgf8a<+>\" allelic genotype describes the combination of gene alleles present at a specific gene locus (the fgf8a locus - which here has a heterozygous state). 2. The human allelic genotypes in the VCF records describes below describe the set of SNPs present at specific positions on Chromosome 20 in the human genome. The first record describes a heterozygouse C/T allelic genotype at Chr20:2300608, and the second describes a homozygous G/G allelic genotype at Chr20:2301308. ##fileformat=VCFv4.2 ##FORMAT= #CHROM POS REF ALT FILTER FORMAT SAMP001 20 2300608 C T PASS GT 0/1 20 2301308 T G PASS GT 1/1 (derived from https://faculty.washington.edu/browning/beagle/intro-to-vcf.html) 3. Some allelic genotype formats encode the genotype as a single string - e.g. \"GRCh38 Chr12:258635(A;T)\" describes a heterozygous A/T allelic genotype of SNPs present at a specific position 258635 on human chromosome 12.""" ; obo:IAO_0000115 "A genotype that specifies the 'allelic state' at a particular location in the genome - i.e. the set of alleles present at this locus across all homologous chromosomes." ; obo:IAO_0000118 "single locus genotype" ; a owl:Class ; rdfs:comment """An 'allelic genotype' describes the set of alleles present at a particular location in the genome. This use of the term 'genotype' reflects its use in clinical genetics where variation has historically been assessed at a specific locus, and a genotype describes the allelic state at that particular location. This contrasts to the use of the term 'genotype in model orgnaism communities where it commonly describes the allelic state at all loci in a genome known to vary from an established reference or background.""" ; rdfs:label "allelic genotype"@en ; rdfs:subClassOf obo:GENO_0000719, obo:GENO_0000897, [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom obo:GENO_0000516 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000719 [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom obo:GENO_0000516 ] ) ] . obo:GENO_0000833 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000116 "Exploratory class looking at creating more specific subtypes of associatiosn, and defining identity criteria for each." ; a owl:Class ; rdfs:label "genotype-phenotype association"@en ; rdfs:subClassOf , _:genid553, _:genid555, _:genid565, _:genid567 . obo:GENO_0000834 obo:IAO_0000115 "Used to annotation axioms that define identity criteria for instances of a class." ; a owl:AnnotationProperty ; rdfs:label "is_identity_criteria"@en ; rdfs:range xsd:boolean . obo:GENO_0000839 a owl:Class ; rdfs:label "knockdown reagent targeted gene complement"@en ; rdfs:subClassOf obo:GENO_0000527, [ a owl:Restriction ; owl:onProperty obo:GENO_0000382 ; owl:someValuesFrom obo:GENO_0000504 ] . obo:GENO_0000840 oboInOwl:hasDbXref "LOINC:LA6668-3" ; a owl:ObjectProperty ; rdfs:label "pathogenic_for_condition"@en ; rdfs:subPropertyOf obo:RO_0003303 . obo:GENO_0000841 oboInOwl:hasDbXref "LOINC:LA26332-9" ; a owl:ObjectProperty ; rdfs:label "likely_pathogenic_for_condition"@en ; rdfs:subPropertyOf obo:RO_0003303 . obo:GENO_0000842 obo:IAO_0000115 "Relation between an entity and a condition (disease, phenotype) which it does not cause or contribute to." ; a owl:ObjectProperty ; rdfs:label "non-causal_for_condition"@en ; rdfs:subPropertyOf obo:GENO_0000790 . obo:GENO_0000843 oboInOwl:hasDbXref "LOINC:LA6675-8" ; a owl:ObjectProperty ; rdfs:label "benign_for_condition"@en ; rdfs:subPropertyOf obo:GENO_0000842 . obo:GENO_0000844 oboInOwl:hasDbXref "LOINC:LA26334-5" ; a owl:ObjectProperty ; rdfs:label "likely_benign_for_condition"@en ; rdfs:subPropertyOf obo:GENO_0000842 . obo:GENO_0000845 oboInOwl:hasDbXref "LOINC:LA26333-7" ; a owl:ObjectProperty ; rdfs:label "has_uncertain_significance_for_condition"@en ; rdfs:subPropertyOf obo:GENO_0000790 . obo:GENO_0000846 obo:IAO_0000115 "A relation used to describe a process contextualizing the identity of an entity." ; a owl:ObjectProperty ; rdfs:label "has_qualifying_process"@en ; rdfs:subPropertyOf obo:GENO_0000580 . obo:GENO_0000847 obo:IAO_0000115 "A relation used to describe an environment contextualizing the identity of an entity." ; a owl:ObjectProperty ; rdfs:label "has_qualifying_environment"@en ; rdfs:subPropertyOf obo:GENO_0000580 . obo:GENO_0000848 obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A sequence alteration within the coding sequence of a gene." ; obo:IAO_0000231 """Not required at this poitn, so marked exploratory and obsoleted. Asserted under sequence_alteration.""" ; a owl:Class ; rdfs:label "obsolete coding sequence alteration" ; owl:deprecated true . obo:GENO_0000849 a owl:ObjectProperty ; rdfs:label "is_candidate_variant_for"@en ; rdfs:subPropertyOf obo:GENO_0000790 . obo:GENO_0000850 obo:IAO_0000115 "A construct that contains a mobile P-element, holding sequences to be delivered to a target cell or genome." ; a owl:Class ; rdfs:label "P-element construct"@en ; rdfs:subClassOf obo:GENO_0000856 . obo:GENO_0000856 obo:IAO_0000115 "An engineered region that is used to transfer foreign genetic material into a host cell." ; obo:IAO_0000118 "engineered_genetic_vector" ; a owl:Class ; rdfs:comment """Constructs can be engineered to carry inserts of DNA from external sources, for purposes of cloning and propagation or gene expression in host cells. Constructs are typically packaged as part of delivery systems such as plasmids or viral vectors.""" ; rdfs:label "engineered genetic construct"@en ; rdfs:subClassOf obo:SO_0000804 . obo:GENO_0000861 obo:IAO_0000115 "A transgene that is not chromosomally integrated in the host genome, but instead exists as part of an extra-chromosomal construct." ; obo:IAO_0000118 "non-integrated transgene" ; a owl:Class ; rdfs:label "extra-chromosomal transgene"@en ; rdfs:subClassOf obo:SO_0000902 . obo:GENO_0000866 obo:IAO_0000112 "The 'rank' quantifier in Bgee gene-anatomy associations, that indicates the imporatnace/specificity of a gene expression in a given anatommy relative to expressionin other anatomies for the same gene." ; obo:IAO_0000115 "Property to link an assertion or association with some value quantifying its relevance or ranking." ; a owl:DatatypeProperty ; rdfs:label "has_quantifier"@en . obo:GENO_0000867 a owl:AnnotationProperty ; rdfs:label "proabalistic_quantifier"@en . obo:GENO_0000870 obo:IAO_0000115 "A collection of more than one sequence feature." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/SO_0001260 ! sequence_collection" ; a owl:Class ; rdfs:label "obsolete sequence feature collection" ; owl:deprecated true . obo:GENO_0000871 obo:IAO_0000115 "A set of discrete, genetically-linked sequence alterations that reside on the same chromosomal strand and are typically co-inherited within a haplotype block." ; obo:IAO_0000116 """Consider if we dont want to define this as a 'complement', as it implies a complet set of memebrs of a defined type. But many haplotypes will be incomplete, due to lack of knowledge of other variation bound by the haplotype block. Instead, we can create an 'allele set' class as the haplotype parent?""" ; dcterms:source "Informed by https://isogg.org/wiki/Haplotype and https://en.wikipedia.org/wiki/Haplotype." ; a owl:Class ; rdfs:comment """A haplotype is a set of non-overlapping alleles that reside in close proximity on the same DNA strand. We model them as 'complements' because they include all known/relevant alleles within a defined region in the genome (e.g. a 'gene', or a 'haplotype block') - where this set may consist of 0, 1, or more alterations from some reference. Because they are genetically linked, the alleles comprising a haplotype are likely to be co-inherited and survive descent across many generations of reproduction. As highlighted in https://en.wikipedia.org/wiki/Haplotype, the term 'haplotype' is most commonly used to describe the following scenarios of genetic linkage between 'alleles': 1. The 'alleles' comprising the haplotype are 'single nucleotide polymorphisms' (SNPs) or other small alterations, which collectively tend to occur together on a chromosomal strand). This use of 'haplotype' is commonly seen in phasing of patient WGS or WES data, to describe a state where two or more alterations that are believed to occur 'in cis' on the same chromosomal strand. 2. The 'alleles' comprising the haplotype are SNPs or other short alterations, which collectively define a specific version of a gene. In this case, the locaiton bounding the haplotype corresponds to a gene locus, and the haplotype defines a specific allele of that gene (i.e 'gene allele'). \"Star alleles\" of PGx genes are examples of this category of haplotype (e.g. https://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/get_allele_hgvs.cgi?A*33:01:01, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4724253/). 3. Each of the 'alleles' comprising the haplotype is itself a 'gene allele' (i.e. a specific version of an entire gene), such that the haolotype contains multiple complete 'gene alleles' that are co-inherited because they reside in tightly linked clusters on a single chromosome. Each of these more specific definition serves a purpose for a particular type of genetic analysis or use case. The GENO definition of 'haplotype' is broadly inclusive of these and any other scenarios where distinct 'alleles' of any kind on the same chromosomal strand are genetically linked, and thus tend to be co-inherited across successive generations.""" ; rdfs:label "haplotype"@en ; rdfs:subClassOf obo:GENO_0000660, [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:GENO_0000512 ] . obo:GENO_0000872 obo:IAO_0000115 "A set of genomic sequences (a biological sequence that is of genomic origin)." ; obo:IAO_0000118 "copy number complement" ; a owl:Class ; rdfs:comment "A 'genomic *sequence* set' differs from a 'genomic *feature* set' in that we are counting how many copies of the same *sequence* exist in a genome, as opposed to how many of the same *sequence feature*. 'Genomic sequence sets' are useful for describing things like 'copy number complements', which are concerned only with how many copies of a sequence exist in a genome, regardless of the location where these reside. By contrast, 'genomic feature sets are useful for representing things like 'single locus complements', where members are sequence features whose identity is dependent on their location." ; rdfs:label "genomic sequence set"@en ; rdfs:subClassOf obo:GENO_0000922 . obo:GENO_0000873 a owl:Class ; rdfs:label "microsatellite alteration"@en ; rdfs:subClassOf obo:GENO_0000874 . obo:GENO_0000874 a owl:Class ; rdfs:label "repeat region alteration"@en ; rdfs:subClassOf obo:SO_0001059 . obo:GENO_0000875 obo:IAO_0000115 "A quality inhering in an 'allelic complement' (aka a 'single locus complement') that describes the allelic variability found at a particular locus in the genome of a single cell/organism" ; a owl:Class ; rdfs:label "allelic state"@en ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000876 obo:IAO_0000118 "allelic dosage", "an attribute inhering in a feature based on the total number or relative stoichiometry of functional copies present in a particular genome.", "gene dosage" ; obo:IAO_0000231 "Remodeled this concept as a 'genetic dosage complement' - a sequence-level class, as opposed to a sequence feature attribute." ; a owl:Class ; rdfs:comment """Genetic dosage reflects how many 'functional' copies of a sequence are present in a genome. In diploid organisms, the normal dosage is 2 for autosomal genes/regions. Dosage increases if there is a duplication of the gene/region. Dosage decreases if there is either a deletion of a gene/region, or an inactivating mutation that eliminates gene function. This sets it apart from the notion of 'copy number', which reflects how many actual copies of a sequence exist in a genome. Addition of a non-functional allele of a gene will increase its copy number, but not increase its dosage. Duplications of a sequence can occur at new locations in the genome, such that the resulting sequence represents a distinct sequence feature from the copy at its native locus. For example, duplication of a region containing the human APOE gene on a different chromosome creates a sequence feature that shares sequence from the original gene, but not location, and therefore represents a different sequence feature. The notions of dosage and copy number are therefore concerned with sequence-level entities (how many copies of a 'sequence' exist), as opposed to sequence feature-level entities. The notion of a single-locus complement would be used to describe how many of a particular features are present in a genome - and describe which alleles of this feature are found.""" ; rdfs:label "obsolete genetic dosage" ; owl:deprecated true . obo:GENO_0000877 obo:IAO_0000115 "A quality inhering in an allele that describes its genetic origin (how it came to be part of a cell's genome), i.e. whether it occurred de novo through some spontaneous mutation event, or was inherited from a parent." ; obo:IAO_0000118 "genetic origin", "variant origin" ; a owl:Class ; rdfs:label "allele origin"@en ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000878 obo:IAO_0000115 "Describes an allele that is inherited from a female parent in virtue of the allele being present in the mother's egg." ; obo:IAO_0000118 "maternally inherited" ; a owl:Class ; rdfs:label "maternal allele origin"@en ; rdfs:subClassOf obo:GENO_0000888 . obo:GENO_0000879 obo:IAO_0000115 "Describes an allele that is inherited from a male parent in virtue of the allele being present in the father's sperm." ; obo:IAO_0000118 "paternally inherited" ; a owl:Class ; rdfs:label "paternal allele origin"@en ; rdfs:subClassOf obo:GENO_0000888 . obo:GENO_0000880 obo:IAO_0000115 "Describes an allele that originated through a mutation event in a germ cell of one of the parents, or in the fertilized egg itself during early embryogenesis. De novo alleles are* heritable* but *not inherited*." ; obo:IAO_0000119 "Derived from https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/de-novo-mutation and https://ghr.nlm.nih.gov/primer/mutationsanddisorders/genemutation" ; a owl:Class ; rdfs:comment """We distinguish germline, somatic, and de novo allele origin based on a combination two key criteria - whether the allele *inherited* from a parent, and whether it is *heritble' by offspring. De novo variants are *heritable* but not *inherited* - as they are not observed constitutively in either parent, but can be passed to offspring in virtue of their being present in the individual's germ cells. By contrast, germline variants are both inherited (passed down from a parent) and heritable (passable down to offspring), and somatic variants are neither inherited or heritable - having originated via a spontaneous mutation in a non-germ cell. De novo variants appear for the first time in one family member. They often explain genetic disorders in which an affected child has a mutation in every cell in the body but the parents do not, and there is no family history of the disorder.""" ; rdfs:label "de novo allele origin"@en ; rdfs:subClassOf obo:GENO_0000877 . obo:GENO_0000881 obo:IAO_0000115 "Describes an allele whose origin is not known." ; a owl:Class ; rdfs:label "unknown allele origin"@en ; rdfs:subClassOf obo:GENO_0000877 . obo:GENO_0000882 obo:IAO_0000115 "Describes an allele that result from some spontaneous mutation event in a somatic cell after fertilization, and thus are not present in every cell in the body." ; obo:IAO_0000118 "acquired" ; obo:IAO_0000119 "Derived from https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/somatic-variant and https://ghr.nlm.nih.gov/primer/mutationsanddisorders/genemutation" ; a owl:Class ; rdfs:comment """We distinguish germline, somatic, and de novo allele origin based on a combination two key criteria - whether the allele *inherited* from a parent, and whether it is *heritble' by offspring. Somatic variants are neither inherited or heritable - having originated via a spontaneous mutation in a non-germ cell. By contrast, germline variants are both inherited (passed down from a parent) and heritable (passable down to offspring). De novo mutations are not inherited but are typically heritable, as they originated through a spontaneous mutation that made them present in germ cells. These acquired mutations are called 'somatic' because they typically affect somatic (non-germ) cells. But when spontaneous do mutations occur in the germ cells of an organism, these can be passed on to offspring in whom they will be considered de novo mutations.""" ; rdfs:label "somatic allele origin"@en ; rdfs:subClassOf obo:GENO_0000877 . obo:GENO_0000883 obo:IAO_0000115 "a quality inhering in a feature in virtue of its presence only in the genome of gametes (germ cells)." ; obo:IAO_0000118 "germ-line" ; obo:IAO_0000231 "replaced by GENO:0000900 ! 'germline'" ; a owl:Class ; rdfs:label "obsolete gametic" ; owl:deprecated true . obo:GENO_0000885 obo:IAO_0000115 """An allelic genotype specifying the set of two alleles present at a particular location in a diploid genome (i.e., a diploid 'single locus complement') Alt: A sequence feature complement comprised of two haplotypes at a particular location on paired homologous chromosomes in a diploid genome.""" ; a owl:Class ; rdfs:comment """\"Humans are diploid organisms; they have paired homologous chromosomes in their somatic cells, which contain two copies of each gene. An allele is one member of a pair of genes occupying a specific spot on a chromosome (called locus). Two alleles at the same locus on homologous chromosomes make up the individual’s genotype. A haplotype (a contraction of the term ‘haploid genotype’) is a combination of alleles at multiple loci that are transmitted together on the same chromosome. Haplotype may refer to as few as two loci or to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci. Genewise haplotypes are established with markers within a gene; familywise haplotypes are established with markers within members of a gene family; and regionwise haplotypes are established within different genes in a region at the same chromosome. Finally, a diplotype is a matched pair of haplotypes on homologous chromosomes.\" From https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4118015/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4118015/figure/sap-26-03-165-g002/""" ; rdfs:label "diplotype"@en ; rdfs:subClassOf obo:GENO_0000823, [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom [ a owl:Class ; owl:intersectionOf (obo:GENO_0000516 [ a owl:Restriction ; owl:onClass obo:GENO_0000512 ; owl:onProperty obo:RO_0002351 ; owl:qualifiedCardinality "2"^^xsd:nonNegativeInteger ] ) ] ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000823 [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom [ a owl:Class ; owl:intersectionOf (obo:GENO_0000516 [ a owl:Restriction ; owl:onClass obo:GENO_0000512 ; owl:onProperty obo:RO_0002351 ; owl:qualifiedCardinality "2"^^xsd:nonNegativeInteger ] ) ] ] ) ] . obo:GENO_0000886 obo:IAO_0000115 "A quality inhering in a collection of discontinuous sequence features in a single genome in virtue of their relative position on the same or separate chromosomes." ; a owl:Class ; rdfs:label "allelic phase" ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000887 a owl:Class ; rdfs:label "oryzias latipes strain" ; rdfs:subClassOf obo:GENO_0000112, [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:NCBITaxon_8090 ], [ a owl:Restriction ; owl:allValuesFrom obo:NCBITaxon_8090 ; owl:onProperty obo:RO_0002351 ] . obo:GENO_0000888 obo:IAO_0000115 "Describes an allele that is inherited from a parent in virtue of the allele being present in the germline of one of the parents." ; obo:IAO_0000118 "hereditary", "parental origin", "parentally inherited" ; obo:IAO_0000119 "Derived from https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/germline-variant and https://ghr.nlm.nih.gov/primer/mutationsanddisorders/genemutation" ; a owl:Class ; rdfs:comment "We distinguish germline, somatic, and de novo allele origin based on a combination two key criteria - whether the allele *inherited* from a parent, and whether it is *heritble' by offspring. Germline variants are both *inherited* (present constitutively in a parent and passed down to offspring) and *heritable* (passable down to future offspring). By contrast, somatic variants are neither inherited or heritable - having originated via a spontaneous mutation in a non-germ cell. Traits caused by de novo mutations in germ cells are not inherited but are typically heritable, as they originated through a spontaneous mutation that made them present a germ cells." ; rdfs:label "germline allele origin"@en ; rdfs:subClassOf obo:GENO_0000974 . obo:GENO_0000889 obo:IAO_0000115 "An inheritance pattern that is not determined or not known." ; obo:IAO_0000118 "unknown inheritance" ; a owl:Class ; rdfs:label "undetermined inheritance" ; rdfs:subClassOf obo:GENO_0000141 . obo:GENO_0000890 obo:IAO_0000112 "The canonical allele that represents a single nucleotide variation in the BRCA2 gene, which can be described by various contextual alleles such as “NC_000013.11:g.32319070T>A” and “NG_012772.3:g.8591T>A”." ; obo:IAO_0000115 "One of a set of sequence features or haplotypes that exist at a particular genetic locus. " ; obo:IAO_0000116 "The notion of a 'canonical allele' is taken from the ClinGen Allele model (http://dataexchange.clinicalgenome.org/allele/). It is implemented in GENO to provide an ontological representation of this concept that will support data integration efforts, but may be replaced by should an IRI become available from the ClinGen model." ; obo:IAO_0000119 "http://dataexchange.clinicalgenome.org/allele/resource/canonical_allele/" ; obo:IAO_0000231 "No longer needed by ClinGen for their interpretation models, and will likely be replaced in ClinGen and elsewhere by VMC/GA4GH modeling constructs." ; dcterms:source "ClinGen Allele Model (http://dataexchange.clinicalgenome.org/allele/)" ; a owl:Class ; rdfs:comment """As a 'sequence feature or collection' (sensu SO), a 'canonical allele' is considered here as an extent of biological sequence encoded in nucleic acid molecules of a cell or organism (as opposed to an information artifact that is about such a sequence). Canonical alleles can include haplotypes that contain more than one discontinuous sequence alteration that exist in cis on the same chromosomal strand. In the ClinGen allele model, 'canonical alleles are contrasted with 'contextual alleles'. Contextual alleles are informational representation that describe a canonical allele using a particular reference sequence. A single canonical allele can be described by many contextual alleles that each use a different reference sequence in their representation (e.g. different chromosomal or transcript references)""" ; rdfs:label "obsolete canonical allele" ; owl:deprecated true . obo:GENO_0000891 obo:IAO_0000115 "An informational artifact that describes a canonical allele by defining its sequence and position relative to a particular reference sequence." ; obo:IAO_0000116 "The notion of a 'contextual allele' is taken from the ClinGen Allele model (http://dataexchange.clinicalgenome.org/allele/). It is implemented in GENO to provide an ontological representation of this concept that will support data integration efforts, but may be replaced by should an IRI become available from the ClinGen model." ; obo:IAO_0000119 "http://dataexchange.clinicalgenome.org/allele/resource/contextual_allele/" ; obo:IAO_0000231 """No longer needed by ClinGen for their interpretation models, and will likely be replaced in ClinGen and elsewhere by VMC/GA4GH modeling constructs. Former axiom: denotes some 'obsolete_canonical allele'""" ; dcterms:source "ClinGen Allele Model (http://dataexchange.clinicalgenome.org/allele/)" ; a owl:Class ; rdfs:comment "The notion of a 'contextual allele' derives from the ClinGen Allele model. Here, each genetic allele in a patient corresponds to a single 'canonical allele', which in turn may aggregate any number of 'contextual allele' representations that are may be defined against different reference sequences. Accordingly, many contextual alleles can describe a single canonical allele. For example, the contextual alleles “NC_000013.11:g.32319070T>A” and “NG_012772.3:g.8591T>A” both describe the same underlying canonical allele, a single nucleotide variation, in the BRCA2 gene." ; rdfs:label "obsolete contextual allele" ; owl:deprecated true . obo:GENO_0000892 obo:IAO_0000115 "A mitochondrial inheritance pattern whereby manifestation of a trait is observed when some inherited mitochondria contian the causative allele and some do not." ; a owl:Class ; rdfs:label "heteroplasmic mitochondrial inheritance" ; rdfs:subClassOf obo:GENO_0000949 . obo:GENO_0000893 obo:IAO_0000115 "A mitochondrial inheritance pattern whereby manifestation of a trait occurs when only mitochondria containing the causative allele are inherited." ; a owl:Class ; rdfs:label "homoplasmic mitochondrial inheritance" ; rdfs:subClassOf obo:GENO_0000949 . obo:GENO_0000894 obo:IAO_0000115 "The starting position of a sequence feature or interval." ; a owl:DatatypeProperty ; rdfs:label "start_position" . obo:GENO_0000895 obo:IAO_0000115 "The ending position of a sequence feature or interval." ; a owl:DatatypeProperty ; rdfs:label "end_position" . obo:GENO_0000896 obo:IAO_0000115 "Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. 'atgcagctagctaccgtcgatcg')." ; a owl:DatatypeProperty ; rdfs:domain obo:GENO_0000702 ; rdfs:label "has_string" ; rdfs:range xsd:string . obo:GENO_0000897 obo:GENO_0000905 true ; obo:IAO_0000115 "An generically dependent continuant that carries biological sequence that is part of or derived from a genome." ; obo:IAO_0000116 "An abstract/organizational class to support data modeling, that includes genomic features, genomic feature complements, qualified genomic features and their complements, as well as genotypes that denote such entities." ; a owl:Class ; rdfs:label "genomic entity"@en ; rdfs:subClassOf obo:BFO_0000031, [ a owl:Restriction ; owl:onProperty obo:RO_0002162 ; owl:someValuesFrom obo:OBI_0100026 ] ; owl:equivalentClass [ a owl:Class ; owl:unionOf (obo:GENO_0000481 [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:GENO_0000481 ] [ a owl:Restriction ; owl:onProperty obo:GENO_0000726 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:GENO_0000481 obo:GENO_0000660 ) ] ] [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:GENO_0000481 obo:GENO_0000660 obo:GENO_0000715 ) ] ] ) ] . obo:GENO_0000898 obo:IAO_0000115 "A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequence alterations it contains are typically co-inherited across generations." ; obo:IAO_0000116 """Consider whether we might better model a 'haplotype block' at the level of a sequence location, rather than a sequence region - e.g. as \"A genomic location over which there is little evidence for historical recombination, such that sequence alterations it contains are typically co-inherited across generations.\" Look at how teh concept is used in research, and if people think of each version of sequence in a haplotype block to be an instance. I think we would just call these versions 'alleles', and then could define haplotype block as a location. Current definition is based on http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block (def = A region of the genome which is co-inherited as the result of the lack of historic recombination within it). If we stick with a region-level treatment, consdier if as a defined region of genomic sequence where variation is known to occur, a haplotype block should be classified as a subtype of allele.""" ; obo:IAO_0000119 "Informed by http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block, and DOI: 10.1126/science.1069424." ; a owl:Class ; rdfs:comment "A particular haplotype block is defined by the set of sequence alterations it is known to contain, which collectively represent a 'haplotype'. The boundaries of haplotype blocks are defined in efforts to identify haplotypes that exist in organisms or populations. A haplotype block may span any number of sequence alterations, and may cover small or large chromosomal regions - depending on the number of recombination events that have occurred between the alterations defining the haplotype." ; rdfs:label "haplotype block"@en ; rdfs:subClassOf obo:GENO_0000481 . obo:GENO_0000899 obo:IAO_0000115 "A genotype that describes the total variation in heritable genomic sequence of a cell or organism, typically in terms of alterations from some reference or background genotype." ; obo:IAO_0000116 """'Genomic Genotype' vs 'Genome' in GENO: A genomic genotype is an information artifact with a representational syntax that can specify what is known about the complete sequence of a genome. This syntax describes 'reference' and 'variant' components - namely a 'background genotype' and 'genomic variation complement' - that must be operated on to resolve the genome sequence. Specifically, the genome sequence is determined by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the reference 'background genotype'. So, while the total sequence content described in a genotype may exceed that of a single a genome (in that it includes a reference genome and variatoin complement), the intended resolution of these sequences is to arrive at a single genome sequence. It is this end-point that we consider when asserting that a genotype 'specifies' a genome.""" ; obo:IAO_0000118 "complete genotype" ; a owl:Class ; rdfs:comment """1. A genomic genotype is a short-hand specification of a genome that uses a representational syntax comprised of information about a reference genome ('genomic background'), and all specific variants from this reference (the 'genomic variation complement'). Conceptually, this variant genome sequence can be resolved by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the reference 'genomic background' sequence. 2. 'Heritable' genomic sequence is that which is passed on to subsequent generations of cells/organisms, and includes all chromosomal sequences, the mitochondrial genome, and any transmissable extrachromosomal replicons.""" ; rdfs:label "genomic genotype"@en ; rdfs:subClassOf obo:GENO_0000719, obo:GENO_0000897, [ a owl:Restriction ; owl:onProperty obo:GENO_0000385 ; owl:someValuesFrom obo:GENO_0000611 ], [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom obo:SO_0001026 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000719 [ a owl:Restriction ; owl:onProperty obo:IAO_0000219 ; owl:someValuesFrom obo:SO_0001026 ] ) ] . obo:GENO_0000901 obo:IAO_0000115 "A quality inhering in a particular allele in virtue of its presence only in a particular type of cell in an organism (e.g. somatic vs germ cells)" ; obo:IAO_0000231 "decided this attribute is not needed, and moved its child 'germline' and 'somatic' concepts under allele origin" ; a owl:Class ; rdfs:comment "Cellular context of an allele is typically defined in the context of evaluating an individual organism, as alleles that are somatic in one organism can be germline in others." ; rdfs:label "obsolete allele cellular context" ; owl:deprecated true . obo:GENO_0000902 obo:IAO_0000115 "The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system" ; obo:IAO_0000116 """In GENO, the notion of a Genomic Location (aka Genomic Locus) plays the same role as that of a FALDO:Region in the design pattern for describing the location of a feature of interest. We define this specific GENO class because the ontological nature of FALDO:Region class is not clear in the context of the BFO and SO-based GENO model. We will work to resolve these questions and ideally converge these concepts in the future. We don't link a Genomic Location to a specific reference sequence because in the FALDO model (which GENO adopts with the exception of swapping GENO:Genomic Locus for FALDO:Region), allows the start and end positions of a region to be defined on separate reference sequences. So while a given Location is conceptually associated with a single reference, in practice it can be pragmatic to define start and stop on different references sequences.""", """In practice, GENO advocates describing biology at the level of genomic features - i.e. define specific terms for genes as genomic features, and not duplicate representation of the loci where each gene resides. So we might define a class representing the human Shh gene as a 'genomic feature', but not parallel this with a 'human Shh gene locus' class. The utility of the 'genomic locus' class in the ontology is primarily to be clear about the distinction, but we would only use it in modeling data if absolutely needed. For example, we would define an 'HLA gene block' as a subclass of 'genomic feature', and assert that HLA-A, HLA-B, and HLA-C genes are part/subsequences of this HLA gene block (as opposed to modeling this as an 'HLA locus' and asserting that the HLA-A, HLA-B, and HLA-C genes occupy this locus).""" ; obo:IAO_0000118 "genomic location", "genomic locus" ; oboInOwl:hasDbXref "VMC:Location" ; a owl:Class ; rdfs:comment """1. A genomic location (aka locus) is defined by its begin and end coordinates on a reference genome, independent of a particular sequence that may reside there. In GENO, we say that a genomic location is occupied_by a 'sequence feature' - where the identity of this feature depends on both it sequence, and its location in the genome (i.e. the locus it occupies). For example, the 'ATG' sequence beginning the ORF of the human SHH gene shares the *same sequence* as the 'ATG' beginning the ORF of the human AKT gene. But these are *distinct sequence features* because they occupy different genomic locations. 2. A given genomic location (e.g. the human SHH gene locus) may be occupied by different alleles (e.g. different alleles of the SHH gene). Within the genome of a single diploid organism, there is potential for two alleles to exist at such a locus (i.e. two different versions of the SHH gene). And across genomes of all members of a species, many more alleles of the SHH gene may exist and occupy this same locus. 3. The notion of a genomic location in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be occupied_by physical objects, while a genomic location is occupied_by sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a genomic locus is distinct from a sequence feature that occupies it. As a more concrete example, consider the distinction between a street address and the building that occupies it as analogous to the relationship between a genomic location and the feature that resides there.""" ; rdfs:label "genomic feature location"@en ; rdfs:subClassOf obo:GENO_0000815 . obo:GENO_0000903 obo:IAO_0000115 "A relation linking a sequence feature to the location it occupies on some reference sequence." ; obo:IAO_0000118 "occupies" ; a owl:ObjectProperty ; rdfs:domain obo:SO_0000110 ; rdfs:label "has_location"@en ; rdfs:range obo:GENO_0000815 . obo:GENO_0000904 obo:GENO_0000905 true ; obo:IAO_0000114 obo:GENO_0000484 ; obo:IAO_0000115 "A material entity that is an organism, derived from an organism, or composed of organisms (e.g. a cell line, biosample, tissue culture, population, etc)." ; obo:IAO_0000116 "useful organizational term to collect entities that have genomes/genotypes." ; a owl:Class ; rdfs:label "organismal entity"@en ; rdfs:subClassOf obo:BFO_0000040 ; owl:equivalentClass [ a owl:Class ; owl:unionOf (obo:OBI_0100026 [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom obo:OBI_0100026 ] [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:OBI_0100026 ] ) ] . obo:GENO_0000905 a owl:AnnotationProperty ; rdfs:comment "Used to flag terms that are created for organizational purposes, e.g. to support groupings useful for defining GENO-based data models." ; rdfs:label "mixin"@en ; rdfs:range xsd:boolean . obo:GENO_0000906 a owl:ObjectProperty ; rdfs:comment "Can be used to a genomic feature to the chromosomal strand it resides on in the genome (+ or - strand, or both strands). Commonly used to link a gene to the strand it is transcribed from." ; rdfs:label "on strand"@en . obo:GENO_0000907 obo:IAO_0000115 "The molecular product resulting from transcription of a single gene (either a protein or RNA molecule)" ; a owl:Class ; rdfs:label "gene product"@en ; rdfs:subClassOf obo:SO_0000110 . obo:GENO_0000909 a owl:AnnotationProperty ; rdfs:label "gene symbol"@en . obo:GENO_0000910 a owl:Class ; rdfs:label "reporter"@en ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000911 a owl:Class ; rdfs:label "selectable marker"@en ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000912 a owl:Class ; rdfs:label "selectable marker region"@en ; rdfs:subClassOf obo:GENO_0000638 . obo:GENO_0000914 obo:IAO_0000115 "A genome whose sequence is identical to that of a genome sequence considered to be the reference." ; a owl:Class ; rdfs:label "reference genome"@en ; rdfs:subClassOf obo:SO_0001026, [ a owl:Restriction ; owl:onProperty obo:GENO_0000239 ; owl:someValuesFrom obo:SO_0001505 ] . obo:GENO_0000915 obo:IAO_0000115 "A haplotype is an allele that represents one of many possible versions of a 'haplotype block', which defines a region of genomic sequence that is typically 'co-inherited' across generations due to a lack of historically observed recombination within it." ; obo:IAO_0000116 "Former comment: \"Each of these more specific definition serves a purpose for a particular type of genetic analysis or use case - e.g. 'SNP allele' haplotypes are identified and analysed in studies to uncover the genetic basis of common disease by efforts like the International HapMap Project.\"" ; obo:IAO_0000119 "Informed by https://isogg.org/wiki/Haplotype and https://en.wikipedia.org/wiki/Haplotype and http://purl.obolibrary.org/obo/SO_0001024 ! haplotype." ; obo:IAO_0000231 """Decided to represent haplotypes as collections of discrete alleles, rather than continuous features defined by such sets. Former SC axioms: - is_allele_of some 'haplotype block' - 'has part' some sequence_alteration""" ; a owl:Class ; rdfs:comment """1. The relationship between 'haplotype' and 'haplotype block' is analogous to the relationship between 'gene allele' and 'gene': a 'gene allele' is one of many possible instances of a 'gene', while a 'haplotype' is one of many possible instances of a 'haplotype block'. In this sense, a gene allele can be considered to be a haplotype whose extent is that of a gene (as it is generally true that there is a low probability of recombination within any given gene). 2. Haplotypes typically contain more than one 'genetically-linked' loci where sequence alterations are known to exist, such that a set of alterations will be co-inherited together across many generations of reproduction. A common use of 'haplotype' is in phasing of patient WGS or WES data, where this term refers to sequence containing two or more alterations that are beleived to occur 'in cis' on the same chromosomal strand. GENO's definition is consistent with but more inclusive than this view, allowing for haplotypes with one or zero established alterations as long as there is a low probability of recombination within the region it spans (such that alterations found in cis are likely to remain in cis across successive generations). As a result, GENO considers any allele that spans an extent greater than that of a single sequence alteration to be a haplotype - as long as there is an expectation of low recombination frequency within the haplotype block occupied by the allele. For example, a 'gene allele' is a haplotype representing a particular version of a gene that contains one or more sequence alterations - as a 'gene' is a region of sequence with a low probability of recombination that is generally expeted to be inherited as a unit. 3. As highlighted in https://en.wikipedia.org/wiki/Haplotype, the term 'haplotype' is most commonly used to describe the following scenarios of genetic linkage between 'alleles': a. The first is regions containing multiple linked 'gene alleles' - i.e. specific versions of entire genes that are co-inherited because they reside in tightly linked clusters on a single chromosome. b. The second is a region containing multiple linked single nucleotide polymorphisms (SNPs) that tend to occur together on a chromosomal strand (i.e. be statistically associated). This use of 'haplotype' is commonly seen in phasing of patient WGS or WES data, to describe a state where two or more alterations that are believed to occur 'in cis' on the same chromosomal strand. c. A third, which is related to the previous case, occurs when the extent of region containing linked SNPs is that of a single gene. In this case, the haplotype represents a 'gene allele' - a version of an entire gene defined by the set of sequence alterations it contains. We may consider this a haplotype as most genes are small enough that there is little chance of recombination events moving cis alterations onto separate chromosomes. The GENO definition of 'haplotype' is broadly inclusive of these and any other scenarios where distinct 'alleles' of any kind on the same chromosomal strand are genetically linked, and thus tend to be co-inherited across successive generations.""" ; rdfs:label "obsolete haplotype" ; owl:deprecated true . obo:GENO_0000916 obo:IAO_0000115 "A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequences it contain are typically co-inherited/transmitted across generations." ; obo:IAO_0000119 "Derived from DOI: 10.1126/science.1069424 and http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block." ; obo:IAO_0000231 "Decided to represent haplotypes as collections of discrete alleles, rather than continuous features defined by such sets." ; a owl:Class ; rdfs:comment """A haplotype block is a class of genomic sequence defined by a lack of evidence for historical recombination, such that sequence alterations within it tend to be co-inherited across successive generations. A haplotype is considered to be one of many possible versions of a 'haplotype block' - defined by the set of co-inherited alterations it contains. In this sense, the relationship between 'haplotype' and 'haplotype block' is analogous to the relationship between 'gene allele' and 'gene'* - a 'gene allele' is one of many possible instances of a 'gene', while a 'haplotype' is one of many possible instances of a 'haplotype block'. The boundaries of haplotype blocks are defined in efforts to identify haplotypes that exist in organisms or populations. A haplotype block may span any number of sequence alterations, and may cover small or large chromosomal regions - depending on the number of recombination events that have occurred between the alterations defining the haplotype. ----------------------- * One difference however is that gene instnaces are necessarily 'functional' - so non-functional alleles of a gene locus wont qualify as gene instances. no such requirement exists for haplotype block instnaces.""" ; rdfs:label "obsolete haplotype block" ; owl:deprecated true . obo:GENO_0000917 obo:IAO_0000115 "Describes the number of members in some set." ; obo:IAO_0000118 "has_count" ; a owl:DatatypeProperty ; rdfs:comment "In GENO, this is used to describe things like the number of sequence features comprising a 'sequence feature set', the number of sequences in a 'biological sequence set', or the number of functional sequences defining a particular 'functional copy number complement'." ; rdfs:label "has_member_count"@en . obo:GENO_0000918 obo:IAO_0000115 "An allelic state that describes the number of different alleles of a gene from an organellar genome (i.e. mitochondrial, plastid) that may exist in a cell." ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:comment "Cells with a population of organelles from a single origin that all share the same organellar genome will contain only one allele of each organellar gene, while cells with populations of organelles of different origins may contain more than one allele of a given organellar gene." ; rdfs:label "organellar plasmy"@en ; rdfs:subClassOf obo:GENO_0000875 . obo:GENO_0000919 obo:IAO_0000112 "Consider wild-type zebrafish shha gene in the context of being targeted by morpholino MO-1 vs morpholino MO-2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'qualified sequence feature' because of their different external contexts. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants (alleles) of the same gene can have potentially different associated phenotypes)." ; obo:IAO_0000115 "A sequence feature whose identity is additionally dependent on the context or state of the material sequence molecule in which the feature is concretized. This context/state describes factors external to the feature's intrinsic sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." ; a owl:Class ; rdfs:comment """GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical state or context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern).""", "Modeling sequence entities at this 'qualified' level is useful for distinguishing cases where features with identical sequence and position as separate instances - based on their material bearers being found in different contexts. For example, consider a situation where the zebrafish shha gene (a sequence feature) is targeted in two experimental groups of fish by two different morpholinos, and phenotypes are assessed for each. We want to be able to represent two 'variants' of the shha gene in this scenario as separate 'qualified sequence feature' instances so we can capture data about the phenotypes resulting from each - just as we would separately represent to different sequence variants (alleles) of the shha gene at the sequence feature level so that we can track their associated phenotypes." ; rdfs:label "qualified sequence feature"@en ; rdfs:subClassOf obo:GENO_0000713 . obo:GENO_0000920 obo:IAO_0000115 "A set of qualified seqeunce features." ; a owl:Class ; rdfs:comment "'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'matehmatical sets'." ; rdfs:label "qualified sequence feature set"@en ; rdfs:subClassOf obo:GENO_0000713, [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:GENO_0000919 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000726 ; owl:someValuesFrom obo:GENO_0000659 ] . obo:GENO_0000921 obo:IAO_0000115 "A biolocical sequence, or set of such sequences." ; obo:IAO_0000118 "biological sequence or collection" ; a owl:Class ; rdfs:label "biological sequence or set"@en ; rdfs:subClassOf obo:BFO_0000031 . obo:GENO_0000922 obo:IAO_0000115 "A set of biological sequences." ; a owl:Class ; rdfs:comment """'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. A set may also include multiple copies of the same sequence. For example, in a 'copy number complement', members are all copies of this same biological sequence.""" ; rdfs:label "biological sequence set"@en ; rdfs:subClassOf obo:GENO_0000921 . obo:GENO_0000923 obo:IAO_0000115 "A set of all features representing *functional* versions of a specified sequence (typically that of a gene) in a particular genome." ; obo:IAO_0000116 "Formerly considered modeling this as an informational entity, defined as \"An information entity that describes the total number of functional copies of a gene or region of sequence in a particular genome.\"" ; obo:IAO_0000118 "functional feature complement", "genetic dosage"@en ; obo:IAO_0000231 "Decided to implement copy number related classes at the sequence level, rather than the sequence feature level. Replaced by GENO:0000963." ; a owl:Class ; rdfs:comment "As for copy number complements, the defining 'sequence' here is specified in terms of a location on a reference sequence - typically the location where a gene or set of genes resides. But the criteria for membership in a functional copy number complement require only that the feature can perform the functions associated with the gene or genes at the defining location. A gene allele that varies by only one nucleotide from the wild-type gene may not qualify if that alteration eliminates the function of the allele. This represents an important distinction between 'copy number' and 'functional copy number'. The former is not concerned with the functionality of sequence copies - only that there is a duplication of sequence in the genome. Thus, the addition of a non-functional allele of a gene will increase its copy number, but not increase its 'functional copy number (aka its dosage).", "The notion of 'functional copy number' (aka 'genetic dosage') describes how many 'functional' copies of a sequence are present in a genome - i.e. sequences that retain their normal activity and/or produce gene products that retain their normal activity. In diploid organisms, the normal dosage is 2 for autosomal genes/regions. Dosage increases if there is a duplication of the gene/region. Dosage decreases if there is either a deletion of a gene/region, or an inactivating mutation that eliminates gene function. This latter condition sets it apart from the notion of a 'copy number complement', which reflects how many actual copies of a sequence exist in a genome. Addition of a non-functional allele of a gene will increase its genomic sequence complement count (i.e. its copy number), but not increase its dosage." ; rdfs:label "obsolete functional copy number complement" ; owl:deprecated true . obo:GENO_0000924 obo:IAO_0000115 "A sequence feature attribute that reflects feature-level characteristics that depend only on the sequence, location, or genomic context of a feature or collection, but are independent of how it may be concretized in physical form." ; a owl:Class ; rdfs:label "obsolete intrinsic sequence feature attribute" ; owl:deprecated true . obo:GENO_0000925 obo:IAO_0000115 "A sequence feature attribute that reflects characteristics of the physical molecule in which the feature is concretized (e.g. its cellular context, source of origin, etc.)" ; a owl:Class ; rdfs:label "obsolete extrinsic sequence feature attribute" ; owl:deprecated true . obo:GENO_0000926 obo:IAO_0000115 "A quality inhering in an allele reflecting whether it is found in all cells of an organism's body, or just some clonal subset (e.g. in mosaicism)." ; a owl:Class ; rdfs:label "allelic cellular distribution"@en ; rdfs:subClassOf obo:GENO_0000788 . obo:GENO_0000927 obo:IAO_0000115 "A cellular distribution in which an allele is found in all cells of an organism's body, typically in virtue of its germline origin." ; a owl:Class ; rdfs:label "constitutional"@en ; rdfs:subClassOf obo:GENO_0000926 . obo:GENO_0000928 obo:IAO_0000115 "A cellular distribuution in which an allele is found only in some clonal subset of cells in an organism, typically in virtue of its somatic origin." ; a owl:Class ; rdfs:label "clonal"@en ; rdfs:subClassOf obo:GENO_0000926 . obo:GENO_0000929 obo:IAO_0000115 "An inheritance pattern that depends on a mixture of major and minor genetic determinants (i.e. alleles of more than one contributing genes), possibly together with environmental factors." ; obo:IAO_0000118 "complex inherritance", "multi-factorial inheritance", "multi-genic inheritance", "multi-locus inheritance", "multigenic inheritance" ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0001426" ; a owl:Class ; rdfs:comment "Diseases inherited in this manner are termed 'complex diseases'." ; rdfs:label "multifactorial inheritance"@en ; rdfs:subClassOf obo:GENO_0000141 . obo:GENO_0000930 obo:IAO_0000115 "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in two genes." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0010984" ; a owl:Class ; rdfs:label "digenic inheritance"@en ; rdfs:subClassOf obo:GENO_0000929 . obo:GENO_0000931 obo:IAO_0000115 "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in few genes." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0010983" ; a owl:Class ; rdfs:comment "It is recommended this term be used for traits governed by three gene loci, although it is noted that usage of this term in the literature is not uniform." ; rdfs:label "oligogenic inheritance"@en ; rdfs:subClassOf obo:GENO_0000929 . obo:GENO_0000932 obo:IAO_0000115 "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles a large number of genes." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0010982" ; a owl:Class ; rdfs:comment "Typically used for traits/conditions governed by more than three gene loci." ; rdfs:label "polygenic inheritance"@en ; rdfs:subClassOf obo:GENO_0000929 . obo:GENO_0000933 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by alleles of a single causal gene, possibly together with environmental factors." ; obo:IAO_0000118 "single-gene inheritance" ; a owl:Class ; rdfs:label "monogenic inheritance"@en ; rdfs:subClassOf obo:GENO_0000141 . obo:GENO_0000934 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a non-sex chromosome." ; a owl:Class ; rdfs:label "autosomal inheritance"@en ; rdfs:subClassOf obo:GENO_0000933 . obo:GENO_0000935 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a sex chromosome." ; obo:IAO_0000118 "gonosomal inheritance" ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0010985" ; a owl:Class ; rdfs:label "allosomal inheritance"@en ; rdfs:subClassOf obo:GENO_0000933 . obo:GENO_0000936 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on an X-chromosome." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0001417" ; a owl:Class ; rdfs:label "X-linked inheritance"@en ; rdfs:subClassOf obo:GENO_0000935 . obo:GENO_0000937 obo:IAO_0000115 "An X-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." ; a owl:Class ; rdfs:label "complete X-linked dominant inheritance"@en ; rdfs:subClassOf obo:GENO_0000146 . obo:GENO_0000938 obo:IAO_0000115 "An X-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." ; obo:IAO_0000118 "semi-dominant X-linked inheritance" ; a owl:Class ; rdfs:label "incomplete X-linked dominant inheritance"@en ; rdfs:subClassOf obo:GENO_0000146 . obo:GENO_0000939 obo:IAO_0000115 "An X-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." ; a owl:Class ; rdfs:label "co-dominant X-linked inheritance"@en ; rdfs:subClassOf obo:GENO_0000146 . obo:GENO_0000941 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Y-chromosome." ; obo:IAO_0000118 "holandric inheritance" ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0001450" ; a owl:Class ; rdfs:label "Y-linked inheritance"@en ; rdfs:subClassOf obo:GENO_0000935 . obo:GENO_0000942 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Z-chromosome." ; a owl:Class ; rdfs:label "Z-linked inheritance"@en ; rdfs:subClassOf obo:GENO_0000935 . obo:GENO_0000943 obo:IAO_0000115 "A Z-linked inheritance pattern wherein the trait manifests in heterozygotes." ; a owl:Class ; rdfs:label "Z-linked dominant inheritance"@en ; rdfs:subClassOf obo:GENO_0000942 . obo:GENO_0000944 obo:IAO_0000115 "A Z-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." ; a owl:Class ; rdfs:label "complete Z-linked dominant inheritance"@en ; rdfs:subClassOf obo:GENO_0000943 . obo:GENO_0000945 obo:IAO_0000115 "A Z-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." ; obo:IAO_0000118 "semi-dominant Z-linked inheritance" ; a owl:Class ; rdfs:label "incomplete Z-linked dominant inheritance"@en ; rdfs:subClassOf obo:GENO_0000943 . obo:GENO_0000946 obo:IAO_0000115 "An Z-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." ; a owl:Class ; rdfs:label "co-dominant Z-linked inheritance"@en ; rdfs:subClassOf obo:GENO_0000943 . obo:GENO_0000947 obo:IAO_0000115 "A Z-linked inheritance pattern wherein a trait caused by alleles of a gene on the Z-chromosome manifests in homozygous but not heterozygote individuals." ; a owl:Class ; rdfs:label "Z-linked reccessive inheritance"@en ; rdfs:subClassOf obo:GENO_0000942 . obo:GENO_0000948 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a W-chromosome." ; a owl:Class ; rdfs:label "W-linked inheritance"@en ; rdfs:subClassOf obo:GENO_0000935 . obo:GENO_0000949 obo:IAO_0000115 "An inheritance pattern observed for traits related to a gene encoded on the mitochondrial genome." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0001427" ; a owl:Class ; rdfs:comment "Because the mitochondrial genome is essentially always maternally inherited, a mitochondrial condition can only be transmitted by females, although the condition can affect both sexes. The proportion of mutant mitochondria can vary (heteroplasmy)." ; rdfs:label "mitochondrial inheritance"@en ; rdfs:subClassOf obo:GENO_0000141 . obo:GENO_0000952 obo:IAO_0000115 "An autosomal dominant inheritance pattern wherein the trait manifests in heterozygotes in a sex-specific manner (i.e. only in males or only in females)." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0001470" ; a owl:Class ; rdfs:label "sex-limited autosomal dominant inheritance"@en ; rdfs:subClassOf obo:GENO_0000147 . obo:GENO_0000953 obo:IAO_0000115 "An autosomal recessive inheritance pattern wherein the trait manifests only in homozygotes, and in a sex-specific manner (i.e. only in males or only in females)." ; oboInOwl:hasDbXref "http://purl.obolibrary.org/obo/HP_0031362" ; a owl:Class ; rdfs:label "sex-limited autosomal recessive inheritance"@en ; rdfs:subClassOf obo:GENO_0000148 . obo:GENO_0000954 obo:IAO_0000115 "A set of discrete alleles within a particular genome." ; a owl:Class ; rdfs:comment "'Sets' are used to model entities that can be comprised of multiple discrete elements - but which can also contain zero or a single member. An \"Allele Set' represents any collection of 0 or more discrete alleles found within a particular genome. The alleles in such a set can be located at distant or close locations in the genome, and if on the same chromosome can be in trans, in cis, or even overlapping When the members of such a set are found 'in cis' on the same chromosome, they may constitute a 'haplotype'. When found 'in trans' at the same location on homologous chromosomes, they may constitute a 'single locus complement'." ; rdfs:label "allele set"@en ; rdfs:subClassOf obo:GENO_0000660 . obo:GENO_0000955 obo:IAO_0000115 "A copy number complement' that has an abnormal number of members (e.g. more or less than two for an autosomal sequence in a diploid genome, as a result of deletion or duplication event(s)." ; obo:IAO_0000118 "copy number variation"@en ; obo:IAO_0000231 "Decided to implement copy number related classes at the sequence level, rather than the sequence feature level." ; a owl:Class ; rdfs:comment """In a 'normal' diploid genome, the copy number complement for any feature (on a non-Y chromosome) contains two members. A copy number variation occurs when a complement contains more or less than two members - as the result of deletion or duplication event(s). Note that the 'copy number variation' class in GENO is related to but ontologically distinct form the SO 'copy_number_variation' class. The GENO class refers to a *set* of all copies of a sequence in a genome, where the number of members in the set is in conflict with the genome's normal ploidy (e.g. not two for a diploid genome). The SO class, which is defined as a sequence feature level concept and therefore represents a single continuous extent of sequence, refers to a single copy of duplicated (or deleted) sequence that comprises the set defined by the GENO CNV class.""" ; rdfs:label "obsolete variant copy number complement" ; owl:deprecated true . obo:GENO_0000956 obo:IAO_0000115 "A set of all features in a particular genome whose sequence aligns with a particular location on a reference genome. Such features are typically on the scale of complete genes or larger." ; obo:IAO_0000231 "Decided to implement copy number related classes at the sequence level, rather than the sequence feature level. Replaced by GENO:0000961." ; a owl:Class ; rdfs:comment """1. Features described by 'copy number' are larger regions of sequence spanning one or more complete genes, or large chromosomal segment. Copies of these regions often become distributed across a genome at unknown locations. By contrast, short repeats, such as tri-nucelotide 'CAG' repeats in the Huntingtin gene, occur at defined locations (adjacent to the originating 'CAG' sequence), and can therefore be modeled as proper alleles. 2. A copy number complement, like any sequence feature complement, is a set of features in a particular genome that meet some criterion. The criterion in this case is that their sequence maps to that of a particular location in a reference sequence. So a copy number complement is the set of all features that share or align with a specified sequence defined on some reference. The sequence of member sequences need not exactly match that of the reference, as copies may accrue some alterations. What is important is that conceptually they represent exact or inexact copies of the reference sequence at a defining location. 3. In a 'normal' diploid genome, the copy number complement for any feature (on a non-Y chromosome) contains two members. A copy number variation occurs when a complement contains more or less than two members - as the result of deletion or duplication event(s). In GENO, a 'copy number variation' refers to a copy number complement' that has an abnormal number of members.""" ; rdfs:label "obsolete copy number complement" ; owl:deprecated true . obo:GENO_0000957 obo:IAO_0000115 "Holds between a copy number complement or functional copy number complement, and a genomic location that serves as a proxy for the sequence or functional element that defines the complement." ; a owl:ObjectProperty ; rdfs:comment """Copy number complements represent sets of all copies of a particular biological sequence present in a particular genome. Their \"identity\" is based on their defining sequence, and the count of this sequence in the genome.The has_defining_location property is used to specify the sequence defining a copy number complement - by using a 'sequence location' as a proxy for a specific sequence that is found at this location. For copy number complements, it is the sequence at this location on some reference that defines sequences in a genome of interest that qualify for membership in the complement. For functional copy number complements (aka genetic dosage), it is the canonical function(s) performed by the sequence at this location (typically that of a gene) that helps to define sequences in a genome of interest that qualify for membership in the complement.""" ; rdfs:domain [ a owl:Class ; owl:unionOf (obo:GENO_0000961 obo:GENO_0000963 ) ] ; rdfs:label "has_defining_location"@en ; rdfs:range obo:GENO_0000815 . obo:GENO_0000958 obo:IAO_0000115 "Holds between a copy number complement or functional copy number complement, and the biological sequence that defines the complement." ; a owl:ObjectProperty ; rdfs:comment "Copy number complements represent sets of all copies of a particular biological sequence present in a particular genome. Their \"identity\" is based on their defining sequence, and the count of this sequence in the genome.The has_defining_sequence property is used to specify the sequence defining a copy number complement." ; rdfs:domain [ a owl:Class ; owl:unionOf (obo:GENO_0000961 obo:GENO_0000963 ) ] ; rdfs:label "has_defining_sequence"@en ; rdfs:range obo:GENO_0000702 . obo:GENO_0000959 obo:IAO_0000115 "Holds between a copy number complement or functional copy number complement and a genomic feature that serves as a proxy for the sequence that defines the complement." ; a owl:ObjectProperty ; rdfs:comment """Copy number complements represent sets of all copies of a particular biological sequence present in a particular genome. Their \"identity\" is based on their defining sequence, and the count of this sequence in the genome.The has_defining_feature property is used to specify the sequence defining a copy number complement - by using a 'sequence feature' as a proxy for the specific sequence of this feature on some reference. For copy number complements, it is the sequence of this proxy feature on some reference that defines sequences in a genome of interest that qualify for membership in the complement. For functional copy number complements (aka genetic dosage), it is the canonical function(s) performed by the sequence of this proxy feature (typically a gene) that helps to define sequences in a genome of interest that qualify for membership in the complement.""" ; rdfs:domain [ a owl:Class ; owl:unionOf (obo:GENO_0000961 obo:GENO_0000963 ) ] ; rdfs:label "has_defining_feature"@en ; rdfs:range obo:SO_0000110 . obo:GENO_0000960 obo:IAO_0000115 "A biological sequence that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)." ; a owl:Class ; rdfs:comment "A sequence being 'of genomic origin' here means only that it has been located to the genome of some organism by alignment with some reference genomic sequence. This is because the sequence was originally identified in, or artificially created to replicate, sequence from an organism's genome." ; rdfs:label "genomic sequence"@en ; rdfs:subClassOf obo:GENO_0000702, [ a owl:Restriction ; owl:onProperty obo:GENO_0000251 ; owl:someValuesFrom obo:GENO_0000481 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:GENO_0000251 ; owl:someValuesFrom obo:GENO_0000481 ] . obo:GENO_0000961 obo:IAO_0000115 "A set representing the complement of all copies of a particular biological sequence (typically at the scale of complete genes or larger) present in a particular genome." ; obo:IAO_0000116 """The identity of a 'copy number complement' instance is determined by the sequence defining its members, and their count (the number of times this sequence appears in a particular genome). In reality the sequence of each copy may not be identical, given the tendency of large regions to accumulate subtle variations. What matters is that they share a common origin/alignment with a defining location in a reference genome. We represent the notion of copy number at the \"sequence level\" (as opposed to the \"sequence feature level\") because we are concerned only with the number of copies of a sequence in a genome, and not the location of the features bearing this sequence. Consider a copy number complement comprised of three copies of the sequence defined by the location Chr8 100000-200000 on a GRCh38.2 reference genome. In one person's genome, this sequence may appear at its normal location on Chromosome 8, as well as in duplications on chromosomes 5, and 12. In another genome the sequence might appear three times as well, but on chromosomes 8, 9, and 15. When representing causal associations linking copy number to disease, it is important that these are considered to be *the same* copy number complement - because what a curator associates with a disease is the presence of three copies of some sequence in a genome, independent of their location. The \"sequence level\" representation here supports this use case. By contrast, a \"feature level\" representation, where identity of a copy number complement would be based on the identity of member *features*), does not - because we have two sets comprised of entirely different features (based on location being tied to their identity).""" ; a owl:Class ; rdfs:comment """The count of how many of a particular sequences are found in a genome is the sequences 'copy number'. In diploid organisms, the normal copy number for sequences at most locations is 2 (a notable exception being those on the X-chromosome where normal copy number is 1). Variations in copy number occur if this count increases due to a duplication of the gene/region, or decreases due to a deletion of a gene/region. A driving use case for representing copy number is to support associations between variation in copy number of a particular sequence, and phenotypes or diseases that can result. A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a set may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features, such as 'copy number complements' representing the set of all copies of a particular sequence in a genome. The fact that we are counting how many copies of the same *sequence* exist in a genome here, as opposed to how many of the same *feature*, is what sets sequence-level concepts like 'copy number complement' apart from feature-level concepts like 'single locus complement'. To illustrate the difference, consider a duplication event that creates a new copy of the human APOE gene on a different chromosome. This creates an entirely new sequence feature at a distinct locus from that of the original APOE gene. The 'copy number complement' for sequence defined by the APOE gene locus would have a count of three, as this sequence is present three times in the genome. But the 'single locus complement' at the APOE gene locus would still have a count of two - because the duplicated copy is at a different location in the genome, and therefore does not represent a copy of the APOE locus.""", "The notion of a 'complement' is useful as a special case of a set, where the members necessarily comprise an exhaustive collection of *all* objects that make up some well-defined set. Here, a 'copy number complement' represents 'represents the set of *all* copies of a specified sequence in a particular genome. Note that sequences can be duplicated in a set (i.e. contain more than one member representing the same sequence). In the 'copy number complement' example, each set member is a copy of this same biological sequence." ; rdfs:label "copy number complement"@en ; rdfs:subClassOf obo:GENO_0000872 . obo:GENO_0000962 obo:IAO_0000115 "A 'copy number complement' that has an abnormal number of members, as the result of deletion or duplication event(s)." ; obo:IAO_0000116 """Note that this 'variant copy number complement' class in GENO is related to but ontologically distinct from the SO 'copy number variation' class. The GENO class refers to a *set* of all copies of a sequence in a genome, where the number of members in the set departs from the genome's normal ploidy of sequences at that location. The SO class, which is defined as a \"sequence feature level\" concept (and therefore represents a single continuous extent of sequence), refers to a sequence alteration such as a deletion or duplication that changes the copy number of the affected sequence, and would result in the presence of a 'variant copy number complement'. The presence of an SO 'copy number variation' suggests, but does not guarantee, the existence of a GENO 'variant copy number complement' (e.g. if a second balancing event has occurred). For example, the deletion variant reported in the ClinVar record here (https://www.ncbi.nlm.nih.gov/clinvar/variation/21009/) is a copy number variation in the SO sense - a deletion that likely results in a GENO 'variant copy number complement'. Databases like ClinVar and dbVar type such alterations as 'copy number variants'. But ClinVar also describes 'variant copy number complements' that may result from the presence of one or more SO 'copy number variations' in a given genome, e.g. here ( https://www.ncbi.nlm.nih.gov/clinvar/variation/221691/). In this case, the submitter is asserting that a state in which only one copy of the defined sequence (Chr2: 73601366 - 73673202) exists in a genome is pathogenic for 'Premature ovarian failure'. This requires more knowledge of the complete genomic state than an assertion that a specific SO 'copy number variation' (here, a deletion variant) is pathogenic for the condition - as here we know that not only is one copy deleted, but also that only one copy remains.""" ; a owl:Class ; rdfs:comment "'Abnormal' is typically more or less than two members for an autosomal sequence in a diploid genome, and more or less than one member for a sequence in a non-homologous region of a sex-chromosome." ; rdfs:label "variant copy number complement"@en ; rdfs:subClassOf obo:GENO_0000961 . obo:GENO_0000963 obo:IAO_0000115 "A set representing the complement of all functional versions of a specified sequence (typically that of a gene) in a particular genome." ; obo:IAO_0000118 "functional genetic dosage" ; a owl:Class ; rdfs:comment """A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a set may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features, such as the set of all functional copies of a particular sequence in a genome. This is known as the 'functional copy number' or 'genetic dosage' of the sequence. 'Functional copies' of a sequence are those that exhibit normal activity and/or produce gene products that exhibit normal activity associated with the sequence. The count of functional copies of a gene is often referred to as its 'dosage'. In diploid organisms, the normal 'dosage' is 2 for autosomal genes/regions. Dosage increases if there is a duplication of a functional gene/region. Dosage decreases if there is either a deletion of a gene/region, or an inactivating mutation that eliminates gene function. This sets it apart from the notion of a 'copy number complement', which reflects how many copies of a sequence exist in a genome, regardless of their functionality. Addition of a non-functional allele of a gene will increase its copy number, but not increase its dosage. As we saw for 'copy number complement', the defining sequence here is specified in terms of a location on a reference sequence - typically the location where a gene or set of genes resides. But the criteria for membership in a 'functional' copy number complement require only that the feature can perform the functions associated with the gene or genes at the defining location. A gene allele that varies by only one nucleotide from the wild-type gene may not qualify as functional if that alteration eliminates the activity of the allele.""" ; rdfs:label "functional copy complement"@en ; rdfs:subClassOf obo:GENO_0000872 . obo:GENO_0000964 a owl:Class ; rdfs:comment "A clonal distribution in which an allele arose during embryogenesis and is present in a subset of tissues derived from some common developmental cell or tissue type." ; rdfs:label "mosaic"@en ; rdfs:subClassOf obo:GENO_0000928 . obo:GENO_0000965 obo:IAO_0000115 "A pair of integers representing start and end position of a location on a sequence coordinate system." ; a owl:Class ; rdfs:label "sequence interval" ; rdfs:subClassOf obo:IAO_0000030 . obo:GENO_0000966 obo:IAO_0000115 "Relates a sequence feature location to an interval that defines its start and end position." ; a owl:ObjectProperty ; rdfs:comment "Can be used when Interval objects are employed in representing sequence location. But start and end positions can also be directly attached to a location, avoiding the use of Interval objects." ; rdfs:domain obo:GENO_0000815 ; rdfs:label "has_interval" . obo:GENO_0000967 obo:IAO_0000115 "Relates a 'sequence feature location' to a sequence that it is anchored to." ; a owl:ObjectProperty ; rdfs:label "has_reference_sequence" . obo:GENO_0000968 obo:IAO_0000115 "A role assigned to a sequence feature, collection, or genotype, e.g. serving as a 'reference' against with other sequences are compared." ; a owl:ObjectProperty ; rdfs:comment "The RO:0000087 (has role) property cannot be used here because its domain is explicitly constrained to independent continuants, and sequence features in GENO are generically dependent contnuants." ; rdfs:label "sequence role" ; rdfs:subPropertyOf obo:RO_0000053 . obo:GENO_0000969 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by inheritance of extra, missing, or re-arranged chromosomes possibly together with environmental factors." ; obo:IAO_0000119 "The Alliance of Genomic Resources" ; a owl:Class ; rdfs:label "chromosomal inheritance"@en ; rdfs:subClassOf obo:GENO_0000141 . obo:GENO_0000970 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by inheritance of missing sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors." ; obo:IAO_0000119 "Alliance of Genomic Resources" ; a owl:Class ; rdfs:label "chromosomal deletion inheritance"@en ; rdfs:subClassOf obo:GENO_0000969 . obo:GENO_0000971 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by inheritance of duplicated sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors." ; obo:IAO_0000119 "Alliance of Genomic Resources" ; a owl:Class ; rdfs:label "chromosomal duplication inheritance"@en ; rdfs:subClassOf obo:GENO_0000969 . obo:GENO_0000972 obo:IAO_0000115 "An inheritance pattern wherein the trait is determined by inheritance of translocation or inversion of sections of one or more chromosomes, possibly together with environmental factors." ; obo:IAO_0000119 "Alliance of Genomic Resources" ; a owl:Class ; rdfs:label "chromosomal rearrangement inheritance"@en ; rdfs:subClassOf obo:GENO_0000969 . obo:GENO_0000974 obo:IAO_0000114 "exploratory" ; obo:IAO_0000115 "Describes an allele that is inherited from a parent." ; obo:IAO_0000116 """Need to consider if/how this is different than 'germline allele origin'. One scenario that potentially distinguishes them is the case where a de novo mutation occurs in the germ cells of a parent, and is passed to offspring. This does not qualify as 'germline allele origin', as currently defined. But it would qualify as 'inherited'""" ; a owl:Class ; rdfs:label "inherited allele origin"@en ; rdfs:subClassOf obo:GENO_0000877 . obo:GENO_0000975 obo:IAO_0000114 "exploratory" ; obo:IAO_0000115 "Describes an allele that is part of an allelic complement where both alleles are inherited from the same parent." ; a owl:Class ; rdfs:comment """From Wikidedia: Uniparental inheritance is a non-mendelian form of inheritance that consists of the transmission of genotypes from one parental type to all progeny. That is, all the genes in offspring will originate from only the mother or only the father. This phenomenon is most commonly observed in eukaryotic organelles such as mitochondria and chloroplasts. https://en.wikipedia.org/wiki/Uniparental_inheritance""" ; rdfs:label "uniparental allele origin"@en ; rdfs:subClassOf obo:GENO_0000974 . obo:GENO_0000976 obo:IAO_0000114 "exploratory" ; obo:IAO_0000115 "Describes an allele that is part of an allelic complement where one allele is maternally inherited and other paternally inherited." ; a owl:Class ; rdfs:comment "Biparental inheritance of alleles is typical of normal mendelian inheritance, where offspring inherit a maternal and a paternal copies of a given gene." ; rdfs:label "biparental allele origin"@en ; rdfs:subClassOf obo:GENO_0000974 . obo:GENO_0000978 obo:IAO_0000115 "A disomic zygosity quality inhering in a 'single locus complement' that is comprised of two non-functional copies of a gene. Loss of function may result from the gene being entirely missing via a deletion, or mutated in a way that eliminates its function." ; oboInOwl:hasNarrowSynonym "homozygous null" ; oboInOwl:inSubset geno:agr_zyg ; a owl:Class ; rdfs:label "nullizygous"@en ; rdfs:subClassOf obo:GENO_0000391 . obo:GO_0003674 obo:IAO_0000115 "A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs." ; obo:IAO_0000116 "This is the same as GO molecular function"@en ; a owl:Class ; rdfs:label "gene product or complex activity"@en, "molecular_function" ; rdfs:subClassOf obo:BFO_0000015 . obo:GO_0008150 obo:IAO_0000111 "biological_process" ; obo:IAO_0000115 "A biological process is the execution of a genetically-encoded biological module or program. It consists of all the steps required to achieve the specific biological objective of the module. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence.", "A biological process represents a specific objective that the organism is genetically programmed to achieve. Biological processes are often described by their outcome or ending state, e.g., the biological process of cell division results in the creation of two daughter cells (a divided cell) from a single parent cell. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence." ; obo:IAO_0000412 ; oboInOwl:hasDbXref "Wikipedia:Biological_process" ; a owl:Class ; rdfs:label "biological process"@en, "biological_process" ; rdfs:subClassOf obo:BFO_0000015 ; owl:disjointWith obo:OBI_0000011 . obo:GO_0016301 obo:IAO_0000115 "Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule." ; oboInOwl:hasDbXref "Reactome:R-HSA-6788855", "Reactome:R-HSA-6788867" ; a owl:Class ; rdfs:label "kinase activity" ; rdfs:subClassOf obo:GO_0003674, [ a owl:Restriction ; owl:hasSelf true ; owl:onProperty obo:RO_0002481 ] . obo:GO_0032502 obo:IAO_0000115 "A biological process whose specific outcome is the progression of an integrated living unit: an anatomical structure (which may be a subcellular structure, cell, tissue, or organ), or organism over time from an initial condition to a later condition. [database_cross_reference: GOC:isa_complete]" ; a owl:Class ; rdfs:label "developmental process"@en ; rdfs:subClassOf obo:GENO_0000351 . obo:HP_0000118 a owl:Class ; rdfs:comment "pulling in HP 'phenotypic abnormality' root here" ; rdfs:label "human phenotypic abnormality" ; rdfs:subClassOf obo:UPHENO_0001001 . obo:HsapDv_0000000 obo:IAO_0000116 "Stub class to serve as root of hierarchy for imports of human developmental stages from the Human Developmental Stages Ontology." ; obo:IAO_0000119 "A spatiotemporal region encompassing some part of the life cycle of an organism." ; a owl:Class ; rdfs:label "human life cycle stage"@en ; rdfs:subClassOf obo:GENO_0000351 . obo:IAO_0000002 obo:IAO_0000111 "example to be eventually removed"@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "example to be eventually removed"@en . obo:IAO_0000003 obo:IAO_0000111 "measurement unit label"@en ; obo:IAO_0000112 "Examples of measurement unit labels are liters, inches, weight per volume."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A measurement unit label is as a label that is part of a scalar measurement datum and denotes a unit of measure."@en ; obo:IAO_0000116 """2009-03-16: provenance: a term measurement unit was proposed for OBI (OBI_0000176) , edited by Chris Stoeckert and Cristian Cocos, and subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definition of this, different, term."""@en, "2009-03-16: review of this term done during during the OBI workshop winter 2009 and the current definition was considered acceptable for use in OBI. If there is a need to modify this definition please notify OBI."@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Melanie Courtot"@en ; a owl:Class ; rdfs:label "measurement unit label"@en ; rdfs:subClassOf obo:IAO_0000009 . obo:IAO_0000005 obo:IAO_0000111 "objective specification"@en ; obo:IAO_0000112 "In the protocol of a ChIP assay the objective specification says to identify protein and DNA interaction."@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A directive information entity that describes an intended process endpoint. When part of a plan specification the concretization is realized in a planned process in which the bearer tries to effect the world so that the process endpoint is achieved."@en ; obo:IAO_0000116 "2009-03-16: original definition when imported from OBI read: \"objective is an non realizable information entity which can serve as that proper part of a plan towards which the realization of the plan is directed.\""@en, "2014-03-31: In the example of usage (\"In the protocol of a ChIP assay the objective specification says to identify protein and DNA interaction\") there is a protocol which is the ChIP assay protocol. In addition to being concretized on paper, the protocol can be concretized as a realizable entity, such as a plan that inheres in a person. The objective specification is the part that says that some protein and DNA interactions are identified. This is a specification of a process endpoint: the boundary in the process before which they are not identified and after which they are. During the realization of the plan, the goal is to get to the point of having the interactions, and participants in the realization of the plan try to do that."@en, "Answers the question, why did you do this experiment?"@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Barry Smith"@en, "PERSON: Bjoern Peters"@en, "PERSON: Jennifer Fostel"@en ; obo:IAO_0000118 "goal specification"@en ; obo:IAO_0000119 "OBI Plan and Planned Process/Roles Branch"@en, "OBI_0000217"@en ; a owl:Class ; rdfs:label "objective specification"@en ; rdfs:subClassOf obo:IAO_0000033 . obo:IAO_0000007 obo:IAO_0000112 "Pour the contents of flask 1 into flask 2"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A directive information entity that describes an action the bearer will take."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; obo:IAO_0000119 "OBI Plan and Planned Process branch"@en ; a owl:Class ; rdfs:label "action specification"@en ; rdfs:subClassOf obo:IAO_0000033 . obo:IAO_0000009 obo:IAO_0000111 "datum label"@en ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A label is a symbol that is part of some other datum and is used to either partially define the denotation of that datum or to provide a means for identifying the datum as a member of the set of data with the same label"@en ; obo:IAO_0000116 "http://www.golovchenko.org/cgi-bin/wnsearch?q=label#4n"@en ; obo:IAO_0000117 "GROUP: IAO"@en ; obo:IAO_0000232 """9/22/11 BP: changed the rdfs:label for this class from 'label' to 'datum label' to convey that this class is not intended to cover all kinds of labels (stickers, radiolabels, etc.), and not even all kind of textual labels, but rather the kind of labels occuring in a datum. """ ; a owl:Class ; rdfs:label "datum label"@en ; rdfs:subClassOf obo:IAO_0000030 . obo:IAO_0000010 obo:IAO_0000111 "software"@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 """Software is a plan specification composed of a series of instructions that can be interpreted by or directly executed by a processing unit."""@en ; obo:IAO_0000116 "see sourceforge tracker discussion at http://sourceforge.net/tracker/index.php?func=detail&aid=1958818&group_id=177891&atid=886178"@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Bjoern Peters"@en, "PERSON: Chris Stoeckert"@en, "PERSON: Melanie Courtot"@en ; obo:IAO_0000119 "GROUP: OBI"@en ; a owl:Class ; rdfs:label "software"@en ; rdfs:subClassOf obo:IAO_0000104 . obo:IAO_0000015 obo:IAO_0000111 "information carrier"@en ; obo:IAO_0000112 "In the case of a printed paperback novel the physicality of the ink and of the paper form part of the information bearer. The qualities of appearing black and having a certain pattern for the ink and appearing white for the paper form part of the information carrier in this case."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A quality of an information bearer that imparts the information content"@en ; obo:IAO_0000116 "12/15/09: There is a concern that some ways that carry information may be processes rather than qualities, such as in a 'delayed wave carrier'."@en, "2014-03-10: We are not certain that all information carriers are qualities. There was a discussion of dropping it." ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en ; obo:IAO_0000119 "Smith, Ceusters, Ruttenberg, 2000 years of philosophy"@en ; a owl:Class ; rdfs:label "information carrier"@en ; rdfs:subClassOf obo:BFO_0000019, [ a owl:Restriction ; owl:onProperty obo:RO_0000059 ; owl:someValuesFrom obo:IAO_0000030 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:BFO_0000019 [ a owl:Restriction ; owl:onProperty obo:RO_0000059 ; owl:someValuesFrom obo:IAO_0000030 ] ) ] . obo:IAO_0000027 obo:IAO_0000111 "data item"@en ; obo:IAO_0000112 "Data items include counts of things, analyte concentrations, and statistical summaries."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "An information content entity that is intended to be a truthful statement about something (modulo, e.g., measurement precision or other systematic errors) and is constructed/acquired by a method which reliably tends to produce (approximately) truthful statements."@en ; obo:IAO_0000116 "2/2/2009 Alan and Bjoern discussing FACS run output data. This is a data item because it is about the cell population. Each element records an event and is typically further composed a set of measurment data items that record the fluorescent intensity stimulated by one of the lasers."@en, "2009-03-16: data item deliberatly ambiguous: we merged data set and datum to be one entity, not knowing how to define singular versus plural. So data item is more general than datum."@en, "2009-03-16: removed datum as alternative term as datum specifically refers to singular form, and is thus not an exact synonym."@en, "2014-03-31: See discussion at http://odontomachus.wordpress.com/2014/03/30/aboutness-objects-propositions/", """JAR: datum -- well, this will be very tricky to define, but maybe some information-like stuff that might be put into a computer and that is meant, by someone, to denote and/or to be interpreted by some process... I would include lists, tables, sentences... I think I might defer to Barry, or to Brian Cantwell Smith JAR: A data item is an approximately justified approximately true approximate belief"""@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Chris Stoeckert"@en, "PERSON: Jonathan Rees"@en ; obo:IAO_0000118 "data"@en ; a owl:Class ; rdfs:label "data item"@en ; rdfs:subClassOf obo:IAO_0000030 . obo:IAO_0000030 obo:IAO_0000111 "information content entity"@en ; obo:IAO_0000112 "Examples of information content entites include journal articles, data, graphical layouts, and graphs."@en ; obo:IAO_0000114 obo:IAO_0000122, obo:IAO_0000125 ; obo:IAO_0000115 "A generically dependent continuant that is about some thing."@en, "an information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity"@en ; obo:IAO_0000116 "2014-03-10: The use of \"thing\" is intended to be general enough to include universals and configurations (see https://groups.google.com/d/msg/information-ontology/GBxvYZCk1oc/-L6B5fSBBTQJ)."@en, """information_content_entity 'is_encoded_in' some digital_entity in obi before split (040907). information_content_entity 'is_encoded_in' some physical_document in obi before split (040907). Previous. An information content entity is a non-realizable information entity that 'is encoded in' some digital or physical entity."""@en ; obo:IAO_0000117 "PERSON: Chris Stoeckert"@en ; obo:IAO_0000119 "OBI_0000142"@en ; a owl:Class ; rdfs:label "information content entity", "information content entity"@en ; rdfs:subClassOf obo:BFO_0000031, [ a owl:Restriction ; owl:onProperty obo:IAO_0000136 ; owl:someValuesFrom obo:BFO_0000001 ] . obo:IAO_0000033 obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An information content entity whose concretizations indicate to their bearer how to realize them in a process."@en ; obo:IAO_0000116 "2009-03-16: provenance: a term realizable information entity was proposed for OBI (OBI_0000337) , edited by the PlanAndPlannedProcess branch. Original definition was \"is the specification of a process that can be concretized and realized by an actor\" with alternative term \"instruction\".It has been subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definitionof this, different, term."@en, "2013-05-30 Alan Ruttenberg: What differentiates a directive information entity from an information concretization is that it can have concretizations that are either qualities or realizable entities. The concretizations that are realizable entities are created when an individual chooses to take up the direction, i.e. has the intention to (try to) realize it."@en, "8/6/2009 Alan Ruttenberg: Changed label from \"information entity about a realizable\" after discussions at ICBO"@en, "Werner pushed back on calling it realizable information entity as it isn't realizable. However this name isn't right either. An example would be a recipe. The realizable entity would be a plan, but the information entity isn't about the plan, it, once concretized, *is* the plan. -Alan"@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Bjoern Peters"@en ; a owl:Class ; rdfs:label "directive information entity"@en ; rdfs:subClassOf obo:IAO_0000030, [ a owl:Restriction ; owl:onProperty obo:IAO_0000136 ; owl:someValuesFrom obo:BFO_0000017 ] . obo:IAO_0000037 obo:IAO_0000111 "dot plot"@en ; obo:IAO_0000112 "Dot plot of SSC-H and FSC-H."@en ; obo:IAO_0000114 obo:IAO_0000002 ; obo:IAO_0000115 "A dot plot is a report graph which is a graphical representation of data where each data point is represented by a single dot placed on coordinates corresponding to data point values in particular dimensions."@en ; obo:IAO_0000117 "person:Allyson Lister"@en, "person:Chris Stoeckert"@en ; obo:IAO_0000119 "OBI_0000123"@en, "group:OBI"@en ; a owl:Class ; rdfs:label "dot plot"@en ; rdfs:subClassOf obo:IAO_0000038 . obo:IAO_0000038 obo:IAO_0000111 "graph"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A diagram that presents one or more tuples of information by mapping those tuples in to a two dimensional space in a non arbitrary way."@en ; obo:IAO_0000117 "PERSON: Lawrence Hunter"@en, "person:Alan Ruttenberg"@en, "person:Allyson Lister"@en ; obo:IAO_0000119 "OBI_0000240"@en, "group:OBI"@en ; a owl:Class ; rdfs:label "graph"@en ; rdfs:subClassOf obo:IAO_0000309 . obo:IAO_0000064 obo:IAO_0000111 "algorithm"@en ; obo:IAO_0000112 "PMID: 18378114.Genomics. 2008 Mar 28. LINKGEN: A new algorithm to process data in genetic linkage studies."@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A plan specification which describes the inputs and output of mathematical functions as well as workflow of execution for achieving an predefined objective. Algorithms are realized usually by means of implementation as computer programs for execution by automata."@en ; obo:IAO_0000117 "Philippe Rocca-Serra"@en, "PlanAndPlannedProcess Branch"@en ; obo:IAO_0000119 "OBI_0000270"@en, "adapted from discussion on OBI list (Matthew Pocock, Christian Cocos, Alan Ruttenberg)"@en ; a owl:Class ; rdfs:label "algorithm"@en ; rdfs:subClassOf obo:IAO_0000104 . obo:IAO_0000078 obo:IAO_0000111 "curation status specification"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "The curation status of the term. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value."@en ; obo:IAO_0000116 "Better to represent curation as a process with parts and then relate labels to that process (in IAO meeting)"@en ; obo:IAO_0000117 "PERSON:Bill Bug"@en ; obo:IAO_0000119 "GROUP:OBI:"@en, "OBI_0000266"@en ; a owl:Class ; rdfs:label "curation status specification"@en ; rdfs:subClassOf obo:IAO_0000102 ; owl:equivalentClass [ a owl:Class ; owl:oneOf (obo:IAO_0000002 obo:IAO_0000120 obo:IAO_0000121 obo:IAO_0000122 obo:IAO_0000123 obo:IAO_0000124 obo:IAO_0000125 obo:IAO_0000423 obo:IAO_0000428 ) ] . obo:IAO_0000096 obo:IAO_0000111 "source code module"@en ; obo:IAO_0000112 "The written source code that implements part of an algorithm. Test - if you know that it was written in a specific language, then it can be source code module. We mean here, roughly, the wording of a document such as a perl script."@en ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A source code module is a directive information entity that specifies, using a programming language, some algorithm."@en ; obo:IAO_0000117 "person:Alan Ruttenberg"@en, "person:Chris Stoeckert"@en ; obo:IAO_0000119 "OBI_0000039"@en, "group:OBI"@en ; a owl:Class ; rdfs:label "source code module"@en ; rdfs:subClassOf obo:IAO_0000033 . obo:IAO_0000098 obo:IAO_0000111 "data format specification"@en ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 """A data format specification is the information content borne by the document published defining the specification. Example: The ISO document specifying what encompasses an XML document; The instructions in a XSD file"""@en ; obo:IAO_0000116 """2009-03-16: provenance: term imported from OBI_0000187, which had original definition \"A data format specification is a plan which organizes information. Example: The ISO document specifying what encompasses an XML document; The instructions in a XSD file\""""@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PlanAndPlannedProcess Branch"@en ; obo:IAO_0000119 "OBI branch derived"@en, "OBI_0000187"@en ; a owl:Class ; rdfs:label "data format specification"@en ; rdfs:subClassOf obo:IAO_0000033 . obo:IAO_0000100 obo:IAO_0000111 "data set"@en ; obo:IAO_0000112 "Intensity values in a CEL file or from multiple CEL files comprise a data set (as opposed to the CEL files themselves)."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A data item that is an aggregate of other data items of the same type that have something in common. Averages and distributions can be determined for data sets."@en ; obo:IAO_0000116 "2009/10/23 Alan Ruttenberg. The intention is that this term represent collections of like data. So this isn't for, e.g. the whole contents of a cel file, which includes parameters, metadata etc. This is more like java arrays of a certain rather specific type"@en, "2014-05-05: Data sets are aggregates and thus must include two or more data items. We have chosen not to add logical axioms to make this restriction." ; obo:IAO_0000117 "person:Allyson Lister"@en, "person:Chris Stoeckert"@en ; obo:IAO_0000119 "OBI_0000042"@en, "group:OBI"@en ; a owl:Class ; rdfs:label "data set"@en ; rdfs:subClassOf obo:IAO_0000027 . obo:IAO_0000101 obo:IAO_0000111 "image"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An image is an affine projection to a two dimensional surface, of measurements of some quality of an entity or entities repeated at regular intervals across a spatial range, where the measurements are represented as color and luminosity on the projected on surface."@en ; obo:IAO_0000117 "person:Alan Ruttenberg"@en, "person:Allyson"@en, "person:Chris Stoeckert"@en ; obo:IAO_0000119 "OBI_0000030"@en, "group:OBI"@en ; a owl:Class ; rdfs:label "image"@en ; rdfs:subClassOf obo:IAO_0000308 . obo:IAO_0000102 obo:IAO_0000111 "data about an ontology part"@en ; obo:IAO_0000115 "Data about an ontology part is a data item about a part of an ontology, for example a term"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; obo:IAO_0000118 "ontology metadata" ; a owl:Class ; rdfs:label "data about an ontology part", "data about an ontology part"@en ; rdfs:subClassOf obo:IAO_0000027 . obo:IAO_0000103 obo:IAO_0000111 "failed exploratory term"@en ; obo:IAO_0000115 "The term was used in an attempt to structure part of the ontology but in retrospect failed to do a good job"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; a obo:IAO_0000225, owl:NamedIndividual ; rdfs:label "failed exploratory term"@en . obo:IAO_0000104 obo:IAO_0000111 "plan specification"@en ; obo:IAO_0000112 "PMID: 18323827.Nat Med. 2008 Mar;14(3):226.New plan proposed to help resolve conflicting medical advice."@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A directive information entity with action specifications and objective specifications as parts that, when concretized, is realized in a process in which the bearer tries to achieve the objectives by taking the actions specified."@en ; obo:IAO_0000116 "2009-03-16: provenance: a term a plan was proposed for OBI (OBI_0000344) , edited by the PlanAndPlannedProcess branch. Original definition was \" a plan is a specification of a process that is realized by an actor to achieve the objective specified as part of the plan\". It has been subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definitionof this, different, term."@en, "2014-03-31: A plan specification can have other parts, such as conditional specifications."@en, "Alternative previous definition: a plan is a set of instructions that specify how an objective should be achieved"@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; obo:IAO_0000119 "OBI Plan and Planned Process branch"@en, "OBI_0000344"@en ; a owl:Class ; rdfs:comment """2/3/2009 Comment from OBI review. Action specification not well enough specified. Conditional specification not well enough specified. Question whether all plan specifications have objective specifications. Request that IAO either clarify these or change definitions not to use them"""@en ; rdfs:label "plan specification"@en ; rdfs:subClassOf obo:IAO_0000033, [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:IAO_0000005 ], [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:IAO_0000007 ] . obo:IAO_0000111 obo:IAO_0000111 "editor preferred label", "editor preferred label"@en, "editor preferred term", "editor preferred term"@en, "editor preferred term~editor preferred label" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "The concise, meaningful, and human-friendly name for a class or property preferred by the ontology developers. (US-English)"@en ; obo:IAO_0000117 "PERSON:Daniel Schober"@en ; obo:IAO_0000119 "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "editor preferred label", "editor preferred label"@en, "editor preferred term", "editor preferred term"@en, "editor preferred term~editor preferred label" . obo:IAO_0000112 obo:IAO_0000111 "example of usage"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A phrase describing how a term should be used and/or a citation to a work which uses it. May also include other kinds of examples that facilitate immediate understanding, such as widely know prototypes or instances of a class, or cases where a relation is said to hold."@en ; obo:IAO_0000117 "PERSON:Daniel Schober"@en ; obo:IAO_0000119 "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "example of usage", "example of usage"@en . obo:IAO_0000113 obo:IAO_0000111 "in branch"@en ; obo:IAO_0000115 "An annotation property indicating which module the terms belong to. This is currently experimental and not implemented yet."@en ; obo:IAO_0000117 "GROUP:OBI"@en ; obo:IAO_0000119 "OBI_0000277"@en ; a owl:AnnotationProperty ; rdfs:label "in branch"@en . obo:IAO_0000114 obo:IAO_0000111 "has curation status"@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg"@en, "PERSON:Bill Bug"@en, "PERSON:Melanie Courtot"@en ; a owl:AnnotationProperty ; rdfs:label "has curation status"@en . obo:IAO_0000115 obo:IAO_0000111 "definition", "definition"@en, "textual definition" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "The official OBI definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions."@en, "The official definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions."@en ; obo:IAO_0000116 """2012-04-05: Barry Smith The official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible. Can you fix to something like: A statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property. Alan Ruttenberg Your proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. On the specifics of the proposed definition: We don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. Personally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. We also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with."""@en, """2012-04-05: Barry Smith The official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible. Can you fix to something like: A statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property. Alan Ruttenberg Your proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. On the specifics of the proposed definition: We don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. Personally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. We also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with. """@en ; obo:IAO_0000117 "PERSON:Daniel Schober"@en ; obo:IAO_0000119 "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "definition", "definition"@en, "textual definition" . obo:IAO_0000116 obo:IAO_0000111 "editor note"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An administrative note intended for its editor. It may not be included in the publication version of the ontology, so it should contain nothing necessary for end users to understand the ontology."@en ; obo:IAO_0000117 "PERSON:Daniel Schober"@en ; obo:IAO_0000119 "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "editor note"@en . obo:IAO_0000117 obo:IAO_0000111 "term editor"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people"@en ; obo:IAO_0000116 "20110707, MC: label update to term editor and definition modified accordingly. See https://github.com/information-artifact-ontology/IAO/issues/115."@en ; obo:IAO_0000117 "PERSON:Daniel Schober"@en ; obo:IAO_0000119 "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "term editor"@en . obo:IAO_0000118 obo:IAO_0000111 "alternative label"@en, "alternative term"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A label for a class or property that can be used to refer to the class or property instead of the preferred rdfs:label. Alternative labels should be used to indicate community- or context-specific labels, abbreviations, shorthand forms and the like."@en, "An alternative name for a class or property which means the same thing as the preferred name (semantically equivalent)"@en ; obo:IAO_0000117 "OBO Operations committee", "PERSON:Daniel Schober"@en ; obo:IAO_0000119 "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:comment "Consider re-defing to: An alternative name for a class or property which can mean the same thing as the preferred name (semantically equivalent, narrow, broad or related)." ; rdfs:isDefinedBy ; rdfs:label "alternative label"@en, "alternative term"@en . obo:IAO_0000119 obo:IAO_0000111 "definition source"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "Formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007"@en ; obo:IAO_0000117 "PERSON:Daniel Schober"@en ; obo:IAO_0000119 "Discussion on obo-discuss mailing-list, see http://bit.ly/hgm99w"@en, "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "definition source"@en . obo:IAO_0000120 obo:IAO_0000111 "metadata complete"@en ; obo:IAO_0000115 "Class has all its metadata, but is either not guaranteed to be in its final location in the asserted IS_A hierarchy or refers to another class that is not complete."@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "metadata complete"@en . obo:IAO_0000121 obo:IAO_0000111 "organizational term"@en ; obo:IAO_0000115 "Term created to ease viewing/sort terms for development purpose, and will not be included in a release"@en, "The term was created to ease viewing/sorting terms for development purposes, but will not be included in a release."@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg" ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "organizational term"@en . obo:IAO_0000122 obo:IAO_0000111 "ready for release"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "Class has undergone final review, is ready for use, and will be included in the next release. Any class lacking \"ready_for_release\" should be considered likely to change place in hierarchy, have its definition refined, or be obsoleted in the next release. Those classes deemed \"ready_for_release\" will also derived from a chain of ancestor classes that are also \"ready_for_release.\""@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "ready for release"@en . obo:IAO_0000123 obo:IAO_0000111 "metadata incomplete"@en ; obo:IAO_0000115 "Class is being worked on; however, the metadata (including definition) are not complete or sufficiently clear to the branch editors."@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "metadata incomplete"@en . obo:IAO_0000124 obo:IAO_0000111 "uncurated"@en ; obo:IAO_0000115 "Nothing done yet beyond assigning a unique class ID and proposing a preferred term."@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "uncurated"@en . obo:IAO_0000125 obo:IAO_0000111 "pending final vetting"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "All definitions, placement in the asserted IS_A hierarchy and required minimal metadata are complete. The class is awaiting a final review by someone other than the term editor."@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "pending final vetting"@en . obo:IAO_0000136 obo:IAO_0000112 "This document is about information artifacts and their representations"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A (currently) primitive relation that relates an information artifact to an entity."@en, "is_about is a (currently) primitive relation that relates an information artifact to an entity." ; obo:IAO_0000116 """7/6/2009 Alan Ruttenberg. Following discussion with Jonathan Rees, and introduction of \"mentions\" relation. Weaken the is_about relationship to be primitive. We will try to build it back up by elaborating the various subproperties that are more precisely defined. Some currently missing phenomena that should be considered \"about\" are predications - \"The only person who knows the answer is sitting beside me\" , Allegory, Satire, and other literary forms that can be topical without explicitly mentioning the topic."""@en ; obo:IAO_0000117 "person:Alan Ruttenberg"@en ; obo:IAO_0000119 "Smith, Ceusters, Ruttenberg, 2000 years of philosophy"@en ; a owl:ObjectProperty ; rdfs:domain obo:IAO_0000030 ; rdfs:label "is about", "is about"@en . obo:IAO_0000178 obo:IAO_0000111 "material information bearer"@en ; obo:IAO_0000112 "A page of a paperback novel with writing on it. The paper itself is a material information bearer, the pattern of ink is the information carrier."@en, "a brain"@en, "a hard drive"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A material entity in which a concretization of an information content entity inheres."@en ; obo:IAO_0000117 "GROUP: IAO"@en ; a owl:Class ; rdfs:label "material information bearer"@en ; rdfs:subClassOf obo:BFO_0000040, [ a owl:Restriction ; owl:onProperty obo:RO_0000053 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0000059 ; owl:someValuesFrom obo:IAO_0000030 ] ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:BFO_0000040 [ a owl:Restriction ; owl:onProperty obo:RO_0000053 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0000059 ; owl:someValuesFrom obo:IAO_0000030 ] ] ) ] . obo:IAO_0000179 obo:IAO_0000111 "histogram"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 """A histogram is a report graph which is a statistical description of a distribution in terms of occurrence frequencies of different event classes."""@en ; obo:IAO_0000117 "PERSON:Chris Stoeckert"@en, "PERSON:James Malone"@en, "PERSON:Melanie Courtot"@en ; obo:IAO_0000119 "GROUP:OBI"@en ; a owl:Class ; rdfs:label "histogram"@en ; rdfs:subClassOf obo:IAO_0000038 . obo:IAO_0000180 obo:IAO_0000111 "heatmap"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 """A heatmap is a report graph which is a graphical representation of data where the values taken by a variable(s) are shown as colors in a two-dimensional map."""@en ; obo:IAO_0000117 "PERSON:Chris Stoeckert"@en, "PERSON:James Malone"@en, "PERSON:Melanie Courtot"@en ; obo:IAO_0000119 "GROUP:OBI"@en ; a owl:Class ; rdfs:label "heatmap"@en ; rdfs:subClassOf obo:IAO_0000038 . obo:IAO_0000183 obo:IAO_0000111 "dendrogram"@en ; obo:IAO_0000112 """Dendrograms are often used in computational biology to illustrate the clustering of genes."""@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 """A dendrogram is a report graph which is a tree diagram frequently used to illustrate the arrangement of the clusters produced by a clustering algorithm."""@en ; obo:IAO_0000117 "PERSON:Chris Stoeckert"@en, "PERSON:James Malone"@en, "PERSON:Melanie Courtot"@en ; obo:IAO_0000119 "WEB: http://en.wikipedia.org/wiki/Dendrogram"@en ; a owl:Class ; rdfs:label "dendrogram"@en ; rdfs:subClassOf obo:IAO_0000038 . obo:IAO_0000184 obo:IAO_0000111 "scatter plot"@en ; obo:IAO_0000112 "Comparison of gene expression values in two samples can be displayed in a scatter plot"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A scatterplot is a graph which uses Cartesian coordinates to display values for two variables for a set of data. The data is displayed as a collection of points, each having the value of one variable determining the position on the horizontal axis and the value of the other variable determining the position on the vertical axis."@en ; obo:IAO_0000117 "PERSON:Chris Stoeckert"@en, "PERSON:James Malone"@en, "PERSON:Melanie Courtot"@en ; obo:IAO_0000118 "scattergraph"@en ; obo:IAO_0000119 "WEB: http://en.wikipedia.org/wiki/Scatterplot"@en ; a owl:Class ; rdfs:label "scatter plot"@en ; rdfs:subClassOf obo:IAO_0000038 . obo:IAO_0000219 obo:IAO_0000112 "A person's name denotes the person. A variable name in a computer program denotes some piece of memory. Lexically equivalent strings can denote different things, for instance \"Alan\" can denote different people. In each case of use, there is a case of the denotation relation obtaining, between \"Alan\" and the person that is being named."@en ; obo:IAO_0000115 "A primitive, instance-level, relation obtaining between an information content entity and some portion of reality. Denotation is what happens when someone creates an information content entity E in order to specifically refer to something. The only relation between E and the thing is that E can be used to 'pick out' the thing. This relation connects those two together. Freedictionary.com sense 3: To signify directly; refer to specifically"@en, "Denotes is a primitive, instance-level, relation obtaining between an information content entity and some portion of reality. Denotation is what happens when someone creates an information content entity E in order to specifically refer to something. The only relation between E and the thing is that E can be used to 'pick out' the thing. This relation connects those two together. Freedictionary.com sense 3: To signify directly; refer to specifically" ; obo:IAO_0000116 """2009-11-10 Alan Ruttenberg. Old definition said the following to emphasize the generic nature of this relation. We no longer have 'specifically denotes', which would have been primitive, so make this relation primitive. g denotes r =def r is a portion of reality there is some c that is a concretization of g every c that is a concretization of g specifically denotes r"""@en, "Consdier if this is the best relation for linking genotypes to the genomic entities they specify. We could use the more generic 'is about', or define a new 'specifies' relation that holds between ICEs and something it specifies the nature or creation of." ; obo:IAO_0000117 "person:Alan Ruttenberg"@en ; obo:IAO_0000119 "Conversations with Barry Smith, Werner Ceusters, Bjoern Peters, Michel Dumontier, Melanie Courtot, James Malone, Bill Hogan"@en ; a owl:ObjectProperty ; rdfs:comment ""@en ; rdfs:domain obo:IAO_0000030 ; rdfs:label "denotes", "denotes"@en ; rdfs:range obo:BFO_0000001 ; rdfs:subPropertyOf obo:IAO_0000136 ; owl:inverseOf obo:IAO_0000235 . obo:IAO_0000224 obo:IAO_0000115 "Core is an instance of a grouping of terms from an ontology or ontologies. It is used by the ontology to identify main classes."@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Melanie Courtot"@en ; obo:IAO_0000231 obo:IAO_0000226 ; a owl:NamedIndividual ; rdfs:label "obsolete_core"@en ; owl:deprecated true . obo:IAO_0000225 obo:IAO_0000111 "obsolescence reason specification"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "The reason for which a term has been deprecated. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value."@en ; obo:IAO_0000116 "The creation of this class has been inspired in part by Werner Ceusters' paper, Applying evolutionary terminology auditing to the Gene Ontology."@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Melanie Courtot"@en ; a owl:Class ; rdfs:label "obsolescence reason specification"@en ; rdfs:subClassOf obo:IAO_0000102 ; owl:equivalentClass [ a owl:Class ; owl:oneOf (obo:IAO_0000103 obo:IAO_0000226 obo:IAO_0000227 obo:IAO_0000228 obo:IAO_0000229 ) ], [ a owl:Class ; owl:oneOf (obo:IAO_0000103 obo:IAO_0000226 obo:IAO_0000227 obo:IAO_0000228 obo:IAO_0000229 obo:OMO_0001000 ) ] . obo:IAO_0000226 obo:IAO_0000111 "placeholder removed"@en ; a obo:IAO_0000225, owl:NamedIndividual ; rdfs:label "placeholder removed"@en . obo:IAO_0000227 obo:IAO_0000111 "terms merged"@en ; obo:IAO_0000116 "An editor note should explain what were the merged terms and the reason for the merge."@en ; a obo:IAO_0000225, owl:NamedIndividual ; rdfs:label "terms merged"@en . obo:IAO_0000228 obo:IAO_0000111 "term imported"@en ; obo:IAO_0000116 "This is to be used when the original term has been replaced by a term imported from an other ontology. An editor note should indicate what is the URI of the new term to use."@en ; a obo:IAO_0000225, owl:NamedIndividual ; rdfs:label "term imported"@en . obo:IAO_0000229 obo:IAO_0000111 "term split"@en ; obo:IAO_0000116 "This is to be used when a term has been split in two or more new terms. An editor note should indicate the reason for the split and indicate the URIs of the new terms created."@en ; a obo:IAO_0000225, owl:NamedIndividual ; rdfs:label "term split"@en . obo:IAO_0000231 obo:IAO_0000111 "has obsolescence reason"@en ; obo:IAO_0000115 "Relates an annotation property to an obsolescence reason. The values of obsolescence reasons come from a list of predefined terms, instances of the class obsolescence reason specification."@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg"@en, "PERSON:Melanie Courtot"@en ; a owl:AnnotationProperty ; rdfs:label "has obsolescence reason"@en . obo:IAO_0000232 obo:IAO_0000111 "curator note"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An administrative note of use for a curator but of no use for a user"@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "curator note"@en . obo:IAO_0000233 obo:IAO_0000111 "term tracker item"@en ; obo:IAO_0000112 "the URI for an OBI Terms ticket at sourceforge, such as https://sourceforge.net/p/obi/obi-terms/772/"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "An IRI or similar locator for a request or discussion of an ontology term."@en ; obo:IAO_0000117 "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg"@en ; obo:IAO_0000119 "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:comment "The 'tracker item' can associate a tracker with a specific ontology term."@en ; rdfs:label "term tracker item"@en . obo:IAO_0000234 obo:IAO_0000111 "ontology term requester"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "The name of the person, project, or organization that motivated inclusion of an ontology term by requesting its addition."@en ; obo:IAO_0000117 "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg"@en ; obo:IAO_0000119 "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:comment "The 'term requester' can credit the person, organization or project who request the ontology term." ; rdfs:label "ontology term requester"@en . obo:IAO_0000235 obo:IAO_0000115 "inverse of the relation 'denotes'"@en ; obo:IAO_0000117 "Person: Jie Zheng, Chris Stoeckert, Mike Conlon"@en ; obo:IAO_0000233 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000001 ; rdfs:label "denoted by"@en ; rdfs:range obo:IAO_0000030 . obo:IAO_0000308 obo:IAO_0000111 "figure"@en ; obo:IAO_0000112 "Any picture, diagram or table"@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An information content entity consisting of a two dimensional arrangement of information content entities such that the arrangement itself is about something."@en ; obo:IAO_0000117 "PERSON: Lawrence Hunter"@en ; a owl:Class ; rdfs:label "figure"@en ; rdfs:subClassOf obo:IAO_0000030 . obo:IAO_0000309 obo:IAO_0000111 "diagram"@en ; obo:IAO_0000112 "A molecular structure ribbon cartoon showing helices, turns and sheets and their relations to each other in space."@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A figure that expresses one or more propositions"@en ; obo:IAO_0000117 "PERSON: Lawrence Hunter"@en ; a owl:Class ; rdfs:label "diagram"@en ; rdfs:subClassOf obo:IAO_0000308 . obo:IAO_0000310 obo:IAO_0000111 "document"@en ; obo:IAO_0000112 "A journal article, patent application, laboratory notebook, or a book"@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A collection of information content entities intended to be understood together as a whole"@en ; obo:IAO_0000117 "PERSON: Lawrence Hunter"@en ; a owl:Class ; rdfs:label "document"@en ; rdfs:subClassOf obo:IAO_0000030 . obo:IAO_0000409 obo:IAO_0000111 "denotator type"@en ; obo:IAO_0000112 "The Basic Formal Ontology ontology makes a distinction between Universals and defined classes, where the formal are \"natural kinds\" and the latter arbitrary collections of entities."@en ; obo:IAO_0000115 "A denotator type indicates how a term should be interpreted from an ontological perspective."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; obo:IAO_0000119 "Barry Smith, Werner Ceusters"@en ; a owl:Class ; rdfs:label "denotator type"@en ; rdfs:subClassOf obo:IAO_0000102 ; owl:equivalentClass [ a owl:Class ; owl:oneOf (obo:IAO_0000410 obo:IAO_0000420 obo:IAO_0000421 ) ] . obo:IAO_0000410 obo:IAO_0000111 "universal"@en ; obo:IAO_0000116 "Hard to give a definition for. Intuitively a \"natural kind\" rather than a collection of any old things, which a class is able to be, formally. At the meta level, universals are defined as positives, are disjoint with their siblings, have single asserted parents."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; obo:IAO_0000119 "A Formal Theory of Substances, Qualities, and Universals, http://ontology.buffalo.edu/bfo/SQU.pdf"@en ; a obo:IAO_0000409, owl:NamedIndividual ; rdfs:label "universal"@en . obo:IAO_0000411 obo:IAO_0000111 "is denotator type"@en ; obo:IAO_0000115 "Relates an class defined in an ontology, to the type of it's denotator"@en ; obo:IAO_0000116 "In OWL 2 add AnnotationPropertyRange('is denotator type' 'denotator type')"@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "is denotator type"@en . obo:IAO_0000412 obo:IAO_0000111 "imported from"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "For external terms/classes, the ontology from which the term was imported"@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg"@en, "PERSON:Melanie Courtot"@en ; obo:IAO_0000119 "GROUP:OBI:"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "imported from"@en . obo:IAO_0000420 obo:IAO_0000111 "defined class"@en ; obo:IAO_0000115 "A defined class is a class that is defined by a set of logically necessary and sufficient conditions but is not a universal"@en ; obo:IAO_0000116 "\"definitions\", in some readings, always are given by necessary and sufficient conditions. So one must be careful (and this is difficult sometimes) to distinguish between defined classes and universal."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; a obo:IAO_0000409, owl:NamedIndividual ; rdfs:label "defined class"@en . obo:IAO_0000421 obo:IAO_0000111 "named class expression"@en ; obo:IAO_0000115 "A named class expression is a logical expression that is given a name. The name can be used in place of the expression."@en ; obo:IAO_0000116 "named class expressions are used in order to have more concise logical definition but their extensions may not be interesting classes on their own. In languages such as OWL, with no provisions for macros, these show up as actuall classes. Tools may with to not show them as such, and to replace uses of the macros with their expansions"@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; a obo:IAO_0000409, owl:NamedIndividual ; rdfs:label "named class expression"@en . obo:IAO_0000423 obo:IAO_0000111 "to be replaced with external ontology term"@en ; obo:IAO_0000115 "Terms with this status should eventually replaced with a term from another ontology."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; obo:IAO_0000119 "group:OBI"@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "to be replaced with external ontology term"@en . obo:IAO_0000424 obo:IAO_0000111 "expand expression to"@en ; obo:IAO_0000112 """ObjectProperty: RO_0002104 Label: has plasma membrane part Annotations: IAO_0000424 \"http://purl.obolibrary.org/obo/BFO_0000051 some (http://purl.org/obo/owl/GO#GO_0005886 and http://purl.obolibrary.org/obo/BFO_0000051 some ?Y)\" """@en ; obo:IAO_0000115 "A macro expansion tag applied to an object property (or possibly a data property) which can be used by a macro-expansion engine to generate more complex expressions from simpler ones"@en ; obo:IAO_0000117 "Chris Mungall"@en ; a owl:AnnotationProperty ; rdfs:label "expand expression to"@en . obo:IAO_0000425 obo:IAO_0000111 "expand assertion to"@en ; obo:IAO_0000112 """ObjectProperty: RO??? Label: spatially disjoint from Annotations: expand_assertion_to \"DisjointClasses: (http://purl.obolibrary.org/obo/BFO_0000051 some ?X) (http://purl.obolibrary.org/obo/BFO_0000051 some ?Y)\" """@en ; obo:IAO_0000115 "A macro expansion tag applied to an annotation property which can be expanded into a more detailed axiom."@en ; obo:IAO_0000117 "Chris Mungall"@en ; a owl:AnnotationProperty ; rdfs:label "expand assertion to"@en . obo:IAO_0000426 obo:IAO_0000111 "first order logic expression"@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "first order logic expression"@en . obo:IAO_0000427 obo:IAO_0000111 "antisymmetric property"@en ; obo:IAO_0000112 "part_of antisymmetric property xsd:true"@en ; obo:IAO_0000115 "Use boolean value xsd:true to indicate that the property is an antisymmetric property"@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "antisymmetric property"@en ; rdfs:subPropertyOf obo:OMO_0001001 . obo:IAO_0000428 obo:IAO_0000111 "requires discussion"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A term that is metadata complete, has been reviewed, and problems have been identified that require discussion before release. Such a term requires editor note(s) to identify the outstanding issues."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en ; obo:IAO_0000119 "group:OBI"@en ; a obo:IAO_0000078, owl:NamedIndividual ; rdfs:label "requires discussion"@en . obo:IAO_0000589 obo:IAO_0000111 "OBO foundry unique label"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "An alternative name for a class or property which is unique across the OBO Foundry."@en ; obo:IAO_0000116 "The intended usage of that property is as follow: OBO foundry unique labels are automatically generated based on regular expressions provided by each ontology, so that SO could specify unique label = 'sequence ' + [label], etc. , MA could specify 'mouse + [label]' etc. Upon importing terms, ontology developers can choose to use the 'OBO foundry unique label' for an imported term or not. The same applies to tools ."@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg"@en, "PERSON:Bjoern Peters"@en, "PERSON:Chris Mungall"@en, "PERSON:Melanie Courtot"@en ; obo:IAO_0000119 "GROUP:OBO Foundry "@en ; a owl:AnnotationProperty ; rdfs:label "OBO foundry unique label"@en . obo:IAO_0000596 obo:IAO_0000111 "has ID digit count"@en ; obo:IAO_0000112 """Ontology: Annotations: 'has ID prefix': \"http://purl.obolibrary.org/obo/RO_\" 'has ID digit count' : 7, rdfs:label \"RO id policy\" 'has ID policy for': \"RO\""""@en ; obo:IAO_0000115 "Relates an ontology used to record id policy to the number of digits in the URI. The URI is: the 'has ID prefix\" annotation property value concatenated with an integer in the id range (left padded with \"0\"s to make this many digits)"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "has ID digit count"@en . obo:IAO_0000597 obo:IAO_0000111 "has ID range allocated"@en ; obo:IAO_0000112 """Datatype: idrange:1 Annotations: 'has ID range allocated to': \"Chris Mungall\" EquivalentTo: xsd:integer[> 2151 , <= 2300] """@en ; obo:IAO_0000115 "Relates a datatype that encodes a range of integers to the name of the person or organization who can use those ids constructed in that range to define new terms"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "has ID range allocated to"@en . obo:IAO_0000598 obo:IAO_0000111 "has ID policy for"@en ; obo:IAO_0000112 """Ontology: Annotations: 'has ID prefix': \"http://purl.obolibrary.org/obo/RO_\" 'has ID digit count' : 7, rdfs:label \"RO id policy\" 'has ID policy for': \"RO\""""@en ; obo:IAO_0000115 "Relating an ontology used to record id policy to the ontology namespace whose policy it manages"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "has ID policy for"@en . obo:IAO_0000599 obo:IAO_0000111 "has ID prefix"@en ; obo:IAO_0000112 """Ontology: Annotations: 'has ID prefix': \"http://purl.obolibrary.org/obo/RO_\" 'has ID digit count' : 7, rdfs:label \"RO id policy\" 'has ID policy for': \"RO\""""@en ; obo:IAO_0000115 "Relates an ontology used to record id policy to a prefix concatenated with an integer in the id range (left padded with \"0\"s to make this many digits) to construct an ID for a term being created."@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:label "has ID prefix"@en . obo:IAO_0000600 obo:IAO_0000111 "elucidation"@en ; obo:IAO_0000117 "person:Alan Ruttenberg"@en ; obo:IAO_0000119 "Person:Barry Smith"@en ; obo:IAO_0000600 "Primitive terms in a highest-level ontology such as BFO are terms which are so basic to our understanding of reality that there is no way of defining them in a non-circular fashion. For these, therefore, we can provide only elucidations, supplemented by examples and by axioms"@en ; a owl:AnnotationProperty ; rdfs:isDefinedBy ; rdfs:label "elucidation"@en . obo:IAO_0000601 obo:IAO_0000111 "has associated axiom(nl)"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; obo:IAO_0000119 "Person:Alan Ruttenberg"@en ; obo:IAO_0000600 "An axiom associated with a term expressed using natural language"@en ; a owl:AnnotationProperty ; rdfs:label "has associated axiom(nl)"@en . obo:IAO_0000602 obo:IAO_0000111 "has associated axiom(fol)"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; obo:IAO_0000119 "Person:Alan Ruttenberg"@en ; obo:IAO_0000600 "An axiom expressed in first order logic using CLIF syntax"@en ; a owl:AnnotationProperty ; rdfs:label "has associated axiom(fol)"@en . obo:IAO_0000603 obo:IAO_0000111 "is allocated id range"@en ; obo:IAO_0000115 "Relates an ontology IRI to an (inclusive) range of IRIs in an OBO name space. The range is give as, e.g. \"IAO_0020000-IAO_0020999\""@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:comment "Add as annotation triples in the granting ontology"@en ; rdfs:label "is allocated id range"@en . obo:IAO_0000700 obo:IAO_0000111 "has ontology root term"@en ; obo:IAO_0000115 "Ontology annotation property. Relates an ontology to a term that is a designated root term of the ontology. Display tools like OLS can use terms annotated with this property as the starting point for rendering the ontology class hierarchy. There can be more than one root."@en ; obo:IAO_0000117 "Nicolas Matentzoglu"@en ; a owl:AnnotationProperty ; rdfs:label "has ontology root term"@en . obo:IAO_0006011 obo:IAO_0000111 "may be identical to"@en ; obo:IAO_0000115 "A annotation relationship between two terms in an ontology that may refer to the same (natural) type but where more evidence is required before terms are merged."@en ; obo:IAO_0000117 "David Osumi-Sutherland"@en ; obo:IAO_0000233 "#40"@en ; obo:IAO_0000234 "VFB"@en ; a owl:AnnotationProperty ; rdfs:comment "Edges asserting this should be annotated with to record evidence supporting the assertion and its provenance."@en ; rdfs:label "may be identical to"@en . obo:IAO_0006012 obo:IAO_0000111 "scheduled for obsoletion on or after"@en ; obo:IAO_0000115 "Used when the class or object is scheduled for obsoletion/deprecation on or after a particular date."@en ; obo:IAO_0000117 "Chris Mungall, Jie Zheng"@en ; obo:IAO_0000233 "https://github.com/geneontology/go-ontology/issues/15532"@en, "https://github.com/information-artifact-ontology/ontology-metadata/issues/32"@en ; obo:IAO_0000234 "GO ontology"@en ; a owl:AnnotationProperty ; rdfs:label "scheduled for obsoletion on or after"@en ; rdfs:range xsd:dateTime . obo:IAO_0010000 obo:IAO_0000111 "has axiom id"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; obo:IAO_0000119 "Person:Alan Ruttenberg"@en ; obo:IAO_0000600 "A URI that is intended to be unique label for an axiom used for tracking change to the ontology. For an axiom expressed in different languages, each expression is given the same URI"@en ; a owl:AnnotationProperty ; rdfs:label "has axiom label"@en . obo:IAO_0100001 obo:IAO_0000111 "term replaced by"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "Use on obsolete terms, relating the term to another term that can be used as a substitute"@en ; obo:IAO_0000117 "Person:Alan Ruttenberg"@en ; obo:IAO_0000119 "Person:Alan Ruttenberg"@en ; a owl:AnnotationProperty ; rdfs:comment "Add as annotation triples in the granting ontology"@en ; rdfs:label "term replaced by"@en . obo:IAO_8000000 obo:IAO_0000111 "ontology module"@en ; obo:IAO_0000116 "I have placed this under 'data about an ontology part', but this can be discussed. I think this is OK if 'part' is interpreted reflexively, as an ontology module is the whole ontology rather than part of it."@en ; obo:IAO_0000118 "ontology file"@en ; obo:IAO_0000232 "This class and it's subclasses are applied to OWL ontologies. Using an rdf:type triple will result in problems with OWL-DL. I propose that dcterms:type is instead used to connect an ontology URI with a class from this hierarchy. The class hierarchy is not disjoint, so multiple assertions can be made about a single ontology."@en ; a owl:Class ; rdfs:label "ontology module"@en ; rdfs:subClassOf obo:IAO_0000102 . obo:IAO_8000001 obo:IAO_0000111 "base ontology module"@en ; obo:IAO_0000115 "An ontology module that comprises only of asserted axioms local to the ontology, excludes import directives, and excludes axioms or declarations from external ontologies."@en ; a owl:Class ; rdfs:label "base ontology module"@en ; rdfs:seeAlso ; rdfs:subClassOf obo:IAO_8000000 . obo:IAO_8000002 obo:IAO_0000111 "editors ontology module"@en ; obo:IAO_0000115 "An ontology module that is intended to be directly edited, typically managed in source control, and typically not intended for direct consumption by end-users."@en ; obo:IAO_0000118 "source ontology module"@en ; a owl:Class ; rdfs:label "editors ontology module"@en ; rdfs:subClassOf obo:IAO_8000000 . obo:IAO_8000003 obo:IAO_0000111 "main release ontology module"@en ; obo:IAO_0000115 "An ontology module that is intended to be the primary release product and the one consumed by the majority of tools."@en ; obo:IAO_0000116 "TODO: Add logical axioms that state that a main release ontology module is derived from (directly or indirectly) an editors module"@en ; a owl:Class ; rdfs:label "main release ontology module"@en ; rdfs:subClassOf obo:IAO_8000000 . obo:IAO_8000004 obo:IAO_0000111 "bridge ontology module"@en ; obo:IAO_0000115 "An ontology module that consists entirely of axioms that connect or bridge two distinct ontology modules. For example, the Uberon-to-ZFA bridge module."@en ; a owl:Class ; rdfs:label "bridge ontology module"@en ; rdfs:seeAlso ; rdfs:subClassOf obo:IAO_8000000 . obo:IAO_8000005 obo:IAO_0000111 "import ontology module"@en ; obo:IAO_0000115 "A subset ontology module that is intended to be imported from another ontology."@en ; obo:IAO_0000116 "TODO: add axioms that indicate this is the output of a module extraction process."@en ; obo:IAO_0000118 "import file"@en ; a owl:Class ; rdfs:label "import ontology module"@en ; rdfs:seeAlso ; rdfs:subClassOf obo:IAO_8000006 . obo:IAO_8000006 obo:IAO_0000111 "subset ontology module"@en ; obo:IAO_0000115 "An ontology module that is extracted from a main ontology module and includes only a subset of entities or axioms."@en ; obo:IAO_0000118 "ontology slim"@en, "subset ontology"@en ; a owl:Class ; rdfs:label "subset ontology module"@en ; rdfs:seeAlso , ; rdfs:subClassOf obo:IAO_8000000 . obo:IAO_8000007 obo:IAO_0000111 "curation subset ontology module"@en ; obo:IAO_0000115 "A subset ontology that is intended as a whitelist for curators using the ontology. Such a subset will exclude classes that curators should not use for curation."@en ; a owl:Class ; rdfs:label "curation subset ontology module"@en ; rdfs:subClassOf obo:IAO_8000006 . obo:IAO_8000008 obo:IAO_0000111 "analysis ontology module"@en ; obo:IAO_0000115 "An ontology module that is intended for usage in analysis or discovery applications."@en ; a owl:Class ; rdfs:label "analysis subset ontology module"@en ; rdfs:subClassOf obo:IAO_8000006 . obo:IAO_8000009 obo:IAO_0000111 "single layer ontology module"@en ; obo:IAO_0000115 "A subset ontology that is largely comprised of a single layer or strata in an ontology class hierarchy. The purpose is typically for rolling up for visualization. The classes in the layer need not be disjoint."@en ; obo:IAO_0000118 "ribbon subset"@en ; a owl:Class ; rdfs:label "single layer subset ontology module"@en ; rdfs:subClassOf obo:IAO_8000006 . obo:IAO_8000010 obo:IAO_0000111 "exclusion subset ontology module"@en ; obo:IAO_0000115 "A subset of an ontology that is intended to be excluded for some purpose. For example, a blacklist of classes."@en ; obo:IAO_0000118 "antislim"@en ; a owl:Class ; rdfs:label "exclusion subset ontology module"@en ; rdfs:subClassOf obo:IAO_8000006 . obo:IAO_8000011 obo:IAO_0000111 "external import ontology module"@en ; obo:IAO_0000115 "An imported ontology module that is derived from an external ontology. Derivation methods include the OWLAPI SLME approach."@en ; obo:IAO_0000118 "external import"@en ; a owl:Class ; rdfs:label "external import ontology module"@en ; rdfs:subClassOf obo:IAO_8000005 . obo:IAO_8000012 obo:IAO_0000111 "species subset ontology module"@en ; obo:IAO_0000115 "A subset ontology that is crafted to either include or exclude a taxonomic grouping of species."@en ; obo:IAO_0000118 "taxon subset"@en ; a owl:Class ; rdfs:label "species subset ontology module"@en ; rdfs:seeAlso ; rdfs:subClassOf obo:IAO_8000006 . obo:IAO_8000013 obo:IAO_0000111 "reasoned ontology module"@en ; obo:IAO_0000115 "An ontology module that contains axioms generated by a reasoner. The generated axioms are typically direct SubClassOf axioms, but other possibilities are available."@en ; a owl:Class ; rdfs:label "reasoned ontology module"@en ; rdfs:seeAlso ; rdfs:subClassOf obo:IAO_8000000 . obo:IAO_8000014 obo:IAO_0000111 "generated ontology module"@en ; obo:IAO_0000115 "An ontology module that is automatically generated, for example via a SPARQL query or via template and a CSV."@en ; obo:IAO_0000116 "TODO: Add axioms (using PROV-O?) that indicate this is the output-of some reasoning process"@en ; a owl:Class ; rdfs:label "generated ontology module"@en ; rdfs:subClassOf obo:IAO_8000000 . obo:IAO_8000015 obo:IAO_0000111 "template generated ontology module"@en ; obo:IAO_0000115 "An ontology module that is automatically generated from a template specification and fillers for slots in that template."@en ; a owl:Class ; rdfs:label "template generated ontology module"@en ; rdfs:seeAlso , , ; rdfs:subClassOf obo:IAO_8000014 . obo:IAO_8000016 obo:IAO_0000111 "taxonomic bridge ontology module"@en ; a owl:Class ; rdfs:label "taxonomic bridge ontology module"@en ; rdfs:subClassOf obo:IAO_8000004 . obo:IAO_8000017 obo:IAO_0000111 "ontology module subsetted by expressivity"@en ; a owl:Class ; rdfs:label "ontology module subsetted by expressivity"@en ; rdfs:subClassOf obo:IAO_8000006 . obo:IAO_8000018 obo:IAO_0000111 "obo basic subset ontology module"@en ; obo:IAO_0000115 """A subset ontology that is designed for basic applications to continue to make certain simplifying assumptions; many of these simplifying assumptions were based on the initial version of the Gene Ontology, and have become enshrined in many popular and useful tools such as term enrichment tools. Examples of such assumptions include: traversing the ontology graph ignoring relationship types using a naive algorithm will not lead to cycles (i.e. the ontology is a DAG); every referenced term is declared in the ontology (i.e. there are no dangling clauses). An ontology is OBO Basic if and only if it has the following characteristics: DAG Unidirectional No Dangling Clauses Fully Asserted Fully Labeled No equivalence axioms Singly labeled edges No qualifier lists No disjointness axioms No owl-axioms header No imports"""@en ; a owl:Class ; rdfs:label "obo basic subset ontology module"@en ; rdfs:seeAlso ; rdfs:subClassOf obo:IAO_8000017 . obo:IAO_8000019 obo:IAO_0000111 "ontology module subsetted by OWL profile"@en ; a owl:Class ; rdfs:label "ontology module subsetted by OWL profile"@en ; rdfs:subClassOf obo:IAO_8000017 . obo:IAO_8000020 obo:IAO_0000111 "EL++ ontology module"@en ; a owl:Class ; rdfs:label "EL++ ontology module"@en ; rdfs:subClassOf obo:IAO_8000019 . obo:IAO_alt_id a owl:AnnotationProperty . obo:IAO_created_by a owl:AnnotationProperty . obo:IAO_creation_date a owl:AnnotationProperty . obo:IAO_id a owl:AnnotationProperty . obo:IAO_subset a owl:AnnotationProperty . obo:IAO_xref a owl:AnnotationProperty . obo:MP_0000001 a owl:Class ; rdfs:comment "where to place this depends on if we take the organismal view or the quality centric view." ; rdfs:label "mammalian phenotype" ; rdfs:subClassOf obo:UPHENO_0001001 . obo:NCBITaxon_10090 obo:IAO_0000111 "Mus musculus" ; obo:IAO_0000118 "house mouse", "mouse" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Mus musculus" ; rdfs:subClassOf obo:NCBITaxon_39107 . obo:NCBITaxon_10239 obo:IAO_0000111 "Viruses" ; obo:IAO_0000412 ; a owl:Class ; rdfs:comment "Stub class to serve as root of hierarchy for imports of virus types from relevant ontologies or terminologies." ; rdfs:label "Viruses" ; rdfs:subClassOf obo:OBI_0100026 . obo:NCBITaxon_117571 obo:IAO_0000111 "Euteleostomi" ; obo:IAO_0000118 "bony vertebrates" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Euteleostomi" ; rdfs:subClassOf obo:NCBITaxon_7742 . obo:NCBITaxon_2 obo:IAO_0000111 "Bacteria" ; obo:IAO_0000118 "eubacteria" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Bacteria" ; rdfs:subClassOf obo:OBI_0100026 . obo:NCBITaxon_2157 obo:IAO_0000111 "Archaea" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Archaea" ; rdfs:subClassOf obo:OBI_0100026 . obo:NCBITaxon_2759 obo:IAO_0000111 "Eukaryota" ; obo:IAO_0000118 "eucaryotes", "eukaryotes" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Eukaryota" ; rdfs:subClassOf obo:OBI_0100026 . obo:NCBITaxon_314146 obo:IAO_0000111 "Euarchontoglires" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Euarchontoglires" ; rdfs:subClassOf obo:NCBITaxon_40674 . obo:NCBITaxon_32523 obo:IAO_0000111 "Tetrapoda" ; obo:IAO_0000118 "tetrapods" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Tetrapoda" ; rdfs:subClassOf obo:NCBITaxon_117571 . obo:NCBITaxon_32524 obo:IAO_0000111 "Amniota" ; obo:IAO_0000118 "amniotes" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Amniota" ; rdfs:subClassOf obo:NCBITaxon_32523 . obo:NCBITaxon_33154 obo:IAO_0000111 "Opisthokonta" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Opisthokonta" ; rdfs:subClassOf obo:NCBITaxon_2759 . obo:NCBITaxon_33208 obo:IAO_0000111 "Metazoa" ; obo:IAO_0000118 "metazoans", "multicellular animals" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Metazoa" ; rdfs:subClassOf obo:NCBITaxon_33154 . obo:NCBITaxon_33213 obo:IAO_0000111 "Bilateria" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Bilateria" ; rdfs:subClassOf obo:NCBITaxon_33208 . obo:NCBITaxon_39107 obo:IAO_0000111 "Murinae" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Murinae" ; rdfs:subClassOf obo:NCBITaxon_9989 . obo:NCBITaxon_40674 obo:IAO_0000111 "Mammalia" ; obo:IAO_0000118 "mammals" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Mammalia" ; rdfs:subClassOf obo:NCBITaxon_32524 . obo:NCBITaxon_7742 obo:IAO_0000111 "Vertebrata " ; obo:IAO_0000118 "Vertebrata", "vertebrates" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Vertebrata " ; rdfs:subClassOf obo:NCBITaxon_33213 . obo:NCBITaxon_7955 obo:IAO_0000111 "Danio rerio" ; obo:IAO_0000118 "leopard danio", "zebra danio", "zebra fish", "zebrafish" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Danio rerio" ; rdfs:subClassOf obo:NCBITaxon_117571 . obo:NCBITaxon_8090 a owl:Class ; rdfs:label "Oryzias latipes" ; rdfs:subClassOf obo:OBI_0100026 . obo:NCBITaxon_9606 obo:IAO_0000111 "Homo sapiens" ; obo:IAO_0000118 "human", "human being" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Homo sapiens" ; rdfs:subClassOf obo:NCBITaxon_314146 . obo:NCBITaxon_9989 obo:IAO_0000111 "Rodentia" ; obo:IAO_0000118 "rodent" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "Rodentia" ; rdfs:subClassOf obo:NCBITaxon_314146 . obo:OBI_0000011 obo:IAO_0000111 "planned process", "planned process"@en ; obo:IAO_0000112 "Injecting mice with a vaccine in order to test its efficacy" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A process that realizes a plan which is the concretization of a plan specification."@en, "A processual entity that realizes a plan which is the concretization of a plan specification." ; obo:IAO_0000116 "'Plan' includes a future direction sense. That can be problematic if plans are changed during their execution. There are however implicit contingencies for protocols that an agent has in his mind that can be considered part of the plan, even if the agent didn't have them in mind before. Therefore, a planned process can diverge from what the agent would have said the plan was before executing it, by adjusting to problems encountered during execution (e.g. choosing another reagent with equivalent properties, if the originally planned one has run out.)", "Stub class to serve as root of hierarchy for experimental techniques and processes, defined in GENO or imported from ontologies such as OBI and ERO.", """We are only considering successfully completed planned processes. A plan may be modified, and details added during execution. For a given planned process, the associated realized plan specification is the one encompassing all changes made during execution. This means that all processes in which an agent acts towards achieving some objectives is a planned process.""" ; obo:IAO_0000117 "Bjoern Peters" ; obo:IAO_0000119 "branch derived" ; obo:IAO_0000232 "6/11/9: Edited at workshop. Used to include: is initiated by an agent", "This class merges the previously separated objective driven process and planned process, as they the separation proved hard to maintain. (1/22/09, branch call)"@en ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "planned process", "planned process"@en ; rdfs:subClassOf obo:BFO_0000015, [ a owl:Restriction ; owl:onProperty obo:BFO_0000055 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0000059 ; owl:someValuesFrom obo:IAO_0000104 ] ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:BFO_0000055 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0000059 ; owl:someValuesFrom obo:IAO_0000104 ] ] . obo:OBI_0000014 obo:IAO_0000111 "regulator role" ; obo:IAO_0000112 "Fact sheet - Regulating the companies The role of the regulator. Ofwat is the economic regulator of the water and sewerage industry in England and Wales. http://www.ofwat.gov.uk/aptrix/ofwat/publish.nsf/Content/roleofregulator_factsheet170805"@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "a regulatory role involved with making and/or enforcing relevant legislation and governmental orders"@en ; obo:IAO_0000117 "Person:Jennifer Fostel"@en ; obo:IAO_0000118 "regulator" ; obo:IAO_0000119 "OBI"@en ; a owl:Class ; rdfs:label "regulator role"@en ; rdfs:subClassOf obo:OBI_0000017 . obo:OBI_0000017 obo:IAO_0000111 "regulatory role"@en ; obo:IAO_0000112 "Regulatory agency, Ethics committee, Approval letter; example: Browse these EPA Regulatory Role subtopics http://www.epa.gov/ebtpages/enviregulatoryrole.html Feb 29, 2008"@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "a role which inheres in material entities and is realized in the processes of making, enforcing or being defined by legislation or orders issued by a governmental body."@en ; obo:IAO_0000117 "GROUP: Role branch"@en ; obo:IAO_0000119 "OBI, CDISC"@en ; obo:IAO_0000232 "govt agents responsible for creating regulations; proxies for enforcing regulations. CDISC definition: regulatory authorities. Bodies having the power to regulate. NOTE: In the ICH GCP guideline the term includes the authorities that review submitted clinical data and those that conduct inspections. These bodies are sometimes referred to as competent"@en ; a owl:Class ; rdfs:label "regulatory role"@en ; rdfs:subClassOf obo:BFO_0000023 . obo:OBI_0000018 obo:IAO_0000111 "material supplier role" ; obo:IAO_0000112 "Jackson Labs is an organization which provide mice as experimental material" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "a role realized through the process of supplying materials such as animal subjects, reagents or other materials used in an investigation."@en ; obo:IAO_0000116 "Supplier role is a special kind of service, e.g. biobank" ; obo:IAO_0000117 "PERSON:Jennifer Fostel"@en ; obo:IAO_0000118 "material provider role", "supplier" ; a owl:Class ; rdfs:label "material supplier role"@en ; rdfs:subClassOf obo:OBI_0000947 . obo:OBI_0000023 obo:IAO_0000111 "classified data set" ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A data set that is produced as the output of a class prediction data transformation and consists of a data set with assigned class labels."@en ; obo:IAO_0000117 "PERSON: James Malone", "PERSON: Monnie McGee" ; obo:IAO_0000118 "data set with assigned class labels" ; a owl:Class ; rdfs:label "classified data set"@en ; rdfs:subClassOf obo:IAO_0000100, [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0000663 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0000663 ] . obo:OBI_0000047 obo:IAO_0000111 "processed material"@en ; obo:IAO_0000112 "Examples include gel matrices, filter paper, parafilm and buffer solutions, mass spectrometer, tissue samples"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "Is a material entity that is created or changed during material processing."@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en ; a owl:Class ; rdfs:label "processed material"@en ; rdfs:subClassOf obo:BFO_0000040, [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0000094 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:BFO_0000040 [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0000094 ] ) ] . obo:OBI_0000079 obo:IAO_0000111 "culture medium" ; obo:IAO_0000112 "A growth medium or culture medium is a substance in which microorganisms or cells can grow. Wikipedia, growth medium, Feb 29, 2008"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "a processed material that provides the needed nourishment for microorganisms or cells grown in vitro." ; obo:IAO_0000116 """changed from a role to a processed material based on on Aug 22, 2011 dev call. Details see the tracker item: http://sourceforge.net/tracker/?func=detail&aid=3325270&group_id=177891&atid=886178 Modification made by JZ.""" ; obo:IAO_0000117 "Person: Jennifer Fostel, Jie Zheng"@en ; obo:IAO_0000119 "OBI"@en ; a owl:Class ; rdfs:label "culture medium"@en ; rdfs:subClassOf obo:OBI_0000047 . obo:OBI_0000086 obo:IAO_0000111 "reagent role" ; obo:IAO_0000112 "Buffer, dye, a catalyst, a solvating agent."@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A role inhering in a biological or chemical entity that is intended to be applied in a scientific technique to participate (or have molecular components that participate) in a chemical reaction that facilitates the generation of data about some entity distinct from the bearer, or the generation of some specified material output distinct from the bearer."@en ; obo:IAO_0000117 "PERSON:Matthew Brush"@en ; obo:IAO_0000118 "reagent" ; obo:IAO_0000119 "PERSON:Matthew Brush" ; obo:IAO_0000232 """Feb 10, 2009. changes after discussion at OBI Consortium Workshop Feb 2-6, 2009. accepted as core term. May 28 2013. Updated definition taken from ReO based on discussions initiated in Philly 2011 workshop. Former defnition described a narrower view of reagents in chemistry that restricts bearers of the role to be chemical entities (\"a role played by a molecular entity used to produce a chemical reaction to detect, measure, or produce other substances\"). Updated definition allows for broader view of reagents in the domain of biomedical research to include larger materials that have parts that participate chemically in a molecular reaction or interaction. """ ; a owl:Class ; rdfs:comment """(copied from ReO) Reagents are distinguished from instruments or devices that also participate in scientific techniques by the fact that reagents are chemical or biological in nature and necessarily participate in or have parts that participate in some chemical interaction or reaction during their intended participation in some technique. By contrast, instruments do not participate in a chemical reaction/interaction during the technique. Reagents are distinguished from study subjects/evaluants in that study subjects and evaluants are that about which conclusions are drawn and knowledge is sought in an investigation - while reagents, by definition, are not. It should be noted, however, that reagent and study subject/evaluant roles can be borne by instances of the same type of material entity - but a given instance will realize only one of these roles in the execution of a given assay or technique. For example, taq polymerase can bear a reagent role or an evaluant role. In a DNA sequencing assay aimed at generating sequence data about some plasmid, the reagent role of the taq polymerase is realized. In an assay to evaluate the quality of the taq polymerase itself, the evaluant/study subject role of the taq is realized, but not the reagent role since the taq is the subject about which data is generated. In regard to the statement that reagents are 'distinct' from the specified outputs of a technique, note that a reagent may be incorporated into a material output of a technique, as long as the IDENTITY of this output is distinct from that of the bearer of the reagent role. For example, dNTPs input into a PCR are reagents that become part of the material output of this technique, but this output has a new identity (ie that of a 'nucleic acid molecule') that is distinct from the identity of the dNTPs that comprise it. Similarly, a biotin molecule input into a cell labeling technique are reagents that become part of the specified output, but the identity of the output is that of some modified cell specimen which shares identity with the input unmodified cell specimen, and not with the biotin label. Thus, we see that an important criteria of 'reagent-ness' is that it is a facilitator, and not the primary focus of an investigation or material processing technique (ie not the specified subject/evaluant about which knowledge is sought, or the specified output material of the technique).""" ; rdfs:label "reagent role"@en ; rdfs:subClassOf obo:BFO_0000023 . obo:OBI_0000094 obo:IAO_0000111 "material processing" ; obo:IAO_0000112 "A cell lysis, production of a cloning vector, creating a buffer." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A planned process which results in physical changes in a specified input material"@en ; obo:IAO_0000117 "PERSON: Bjoern Peters"@en, "PERSON: Frank Gibson", "PERSON: Jennifer Fostel", "PERSON: Melanie Courtot", "PERSON: Philippe Rocca Serra" ; obo:IAO_0000118 "material transformation"@en ; obo:IAO_0000119 "OBI branch derived"@en ; a owl:Class ; rdfs:label "material processing"@en ; rdfs:subClassOf obo:OBI_0000011, [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0000047 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000456 ], [ a owl:Restriction ; owl:allValuesFrom obo:BFO_0000040 ; owl:onProperty obo:OBI_0000293 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000456 ] . obo:OBI_0000112 obo:IAO_0000111 "specimen role" ; obo:IAO_0000112 "liver section; a portion of a culture of cells; a nemotode or other animal once no longer a subject (generally killed); portion of blood from a patient." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "a role borne by a material entity that is gained during a specimen collection process and that can be realized by use of the specimen in an investigation"@en ; obo:IAO_0000116 "22Jun09. The definition includes whole organisms, and can include a human. The link between specimen role and study subject role has been removed. A specimen taken as part of a case study is not considered to be a population representative, while a specimen taken as representing a population, e.g. person taken from a cohort, blood specimen taken from an animal) would be considered a population representative and would also bear material sample role.", "Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation.", """blood taken from animal: animal continues in study, whereas blood has role specimen. something taken from study subject, leaves the study and becomes the specimen."""@en, """parasite example - when parasite in people we study people, people are subjects and parasites are specimen - when parasite extracted, they become subject in the following study specimen can later be subject."""@en ; obo:IAO_0000117 "GROUP: Role Branch" ; obo:IAO_0000119 "OBI" ; obo:IAO_0000233 ; a owl:Class ; rdfs:label "specimen role"@en ; rdfs:subClassOf obo:BFO_0000023, [ a owl:Restriction ; owl:onProperty obo:RO_0000052 ; owl:someValuesFrom [ a owl:Class ; owl:intersectionOf (obo:BFO_0000040 [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0000659 ] ) ] ] . obo:OBI_0000181 obo:IAO_0000111 "population"@en ; obo:IAO_0000112 "PMID12564891. Environ Sci Technol. 2003 Jan 15;37(2):223-8. Effects of historic PCB exposures on the reproductive success of the Hudson River striped bass population."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "a population is a collection of individuals from the same taxonomic class living, counted or sampled at a particular site or in a particular area", "a population is a collection of individuals from the same taxonomic class living, counted or sampled at a particular site or in a particular area"@en ; obo:IAO_0000116 """1/28/2013, BP, on the call it was raised that we may want to switch to an external ontology for all populatin terms: http://code.google.com/p/popcomm-ontology/""" ; obo:IAO_0000117 "PERSON: Philippe Rocca-Serra"@en ; obo:IAO_0000119 "adapted from Oxford English Dictionnary"@en ; obo:IAO_0000232 "rem1: collection somehow always involve a selection process"@en ; a owl:Class ; rdfs:label "population"@en ; rdfs:subClassOf obo:GENO_0000113 . obo:OBI_0000245 obo:IAO_0000111 "organization"@en ; obo:IAO_0000112 "PMID: 16353909.AAPS J. 2005 Sep 22;7(2):E274-80. Review. The joint food and agriculture organization of the United Nations/World Health Organization Expert Committee on Food Additives and its role in the evaluation of the safety of veterinary drug residues in foods."@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An entity that can bear roles, has members, and has a set of organization rules. Members of organizations are either organizations themselves or individual people. Members can bear specific organization member roles that are determined in the organization rules. The organization rules also determine how decisions are made on behalf of the organization by the organization members."@en ; obo:IAO_0000116 """BP: The definition summarizes long email discussions on the OBI developer, roles, biomaterial and denrie branches. It leaves open if an organization is a material entity or a dependent continuant, as no consensus was reached on that. The current placement as material is therefore temporary, in order to move forward with development. Here is the entire email summary, on which the definition is based: 1) there are organization_member_roles (president, treasurer, branch editor), with individual persons as bearers 2) there are organization_roles (employer, owner, vendor, patent holder) 3) an organization has a charter / rules / bylaws, which specify what roles there are, how they should be realized, and how to modify the charter/rules/bylaws themselves. It is debatable what the organization itself is (some kind of dependent continuant or an aggregate of people). This also determines who/what the bearer of organization_roles' are. My personal favorite is still to define organization as a kind of 'legal entity', but thinking it through leads to all kinds of questions that are clearly outside the scope of OBI. Interestingly enough, it does not seem to matter much where we place organization itself, as long as we can subclass it (University, Corporation, Government Agency, Hospital), instantiate it (Affymetrix, NCBI, NIH, ISO, W3C, University of Oklahoma), and have it play roles. This leads to my proposal: We define organization through the statements 1 - 3 above, but without an 'is a' statement for now. We can leave it in its current place in the is_a hierarchy (material entity) or move it up to 'continuant'. We leave further clarifications to BFO, and close this issue for now."""@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg", "PERSON: Bjoern Peters", "PERSON: Philippe Rocca-Serra", "PERSON: Susanna Sansone" ; obo:IAO_0000119 "GROUP: OBI" ; a owl:Class ; rdfs:label "organization"@en ; rdfs:subClassOf obo:BFO_0000040 . obo:OBI_0000293 obo:IAO_0000111 "has_specified_input", "has_specified_input"@en ; obo:IAO_0000112 "see is_input_of example_of_usage"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of.", "The inverse property of is_specified_input_of"@en ; obo:IAO_0000116 "8/17/09: specified inputs of one process are not necessarily specified inputs of a larger process that it is part of. This is in contrast to how 'has participant' works." ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Bjoern Peters", "PERSON: Larry Hunter", "PERSON: Melanie Coutot" ; obo:IAO_0000412 ; a owl:ObjectProperty ; rdfs:domain obo:OBI_0000011 ; rdfs:label "has_specified_input", "has_specified_input"@en ; rdfs:subPropertyOf obo:RO_0000057, obo:RO_0002233 ; owl:equivalentProperty [ owl:inverseOf obo:OBI_0000295 ] ; owl:inverseOf obo:OBI_0000295 . obo:OBI_0000295 obo:IAO_0000111 "is_specified_input_of" ; obo:IAO_0000112 "some Autologous EBV(Epstein-Barr virus)-transformed B-LCL (B lymphocyte cell line) is_input_for instance of Chromum Release Assay described at https://wiki.cbil.upenn.edu/obiwiki/index.php/Chromium_Release_assay"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en, "PERSON:Bjoern Peters" ; a owl:ObjectProperty ; rdfs:label "is_specified_input_of"@en ; rdfs:range obo:OBI_0000011 ; rdfs:subPropertyOf obo:RO_0000056 . obo:OBI_0000299 obo:IAO_0000111 "has_specified_output", "has_specified_output"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of.", "The inverse property of is_specified_output_of"@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en, "PERSON: Bjoern Peters", "PERSON: Larry Hunter", "PERSON: Melanie Courtot" ; obo:IAO_0000412 ; a owl:ObjectProperty ; rdfs:domain obo:OBI_0000011 ; rdfs:label "has_specified_output", "has_specified_output"@en ; rdfs:subPropertyOf obo:RO_0000057, obo:RO_0002234 ; owl:equivalentProperty [ owl:inverseOf obo:OBI_0000312 ] ; owl:inverseOf obo:OBI_0000312 . obo:OBI_0000312 obo:IAO_0000111 "is_specified_output_of", "is_specified_output_of"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of."@en ; obo:IAO_0000117 "Alan Ruttenberg"@en, "PERSON:Bjoern Peters" ; obo:IAO_0000412 ; a owl:ObjectProperty ; rdfs:label "is_specified_output_of"@en ; rdfs:range obo:OBI_0000011 ; rdfs:subPropertyOf obo:RO_0000056 . obo:OBI_0000317 obo:IAO_0000111 "Transformation-ML"@en ; obo:IAO_0000112 "Transformation-ML file describing parameter transformations used in a GvHD experiment."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "Transformation-ML is a format standard of a digital entity that is conformant with the Transformation-ML standard.(http://wiki.ficcs.org/ficcs/Transformation-ML?action=AttachFile&do=get&target=Transformation-ML_v1.0.26.pdf)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://wiki.ficcs.org/ficcs/Transformation-ML?action=AttachFile&do=get&target=Transformation-ML_v1.0.26.pdf" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "Transformation-ML"@en . obo:OBI_0000321 obo:IAO_0000111 "ACS"@en ; obo:IAO_0000112 "d06.acs, ACS1.0 data file of well D06 of plate 2 of part 1 of a GvHD experiment."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "ACS is a format standard of a digital entity that is conformant with the Analytical Cytometry Standard. (http://www.isac-net.org/content/view/607/150/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.isac-net.org/content/view/607/150/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "ACS"@en . obo:OBI_0000322 obo:IAO_0000111 "XML"@en ; obo:IAO_0000112 "RDF/XML file, OWL file, Compensation-ML file, WSDL document, SVG document"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "XML is a format standard of a digital entity that is conformant with the W3C Extensible Markup Language Recommendation.(http://www.w3.org/XML/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.w3.org/XML/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "XML"@en . obo:OBI_0000324 obo:IAO_0000111 "RDF"@en ; obo:IAO_0000112 "A FOAF file, a SKOS file, an OWL file."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "RDF is a format standard of a digital entity that is conformant with the W3C Resource Description Framework RDF/XML Syntax specification.(http://www.w3.org/RDF/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.w3.org/RDF/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "RDF"@en . obo:OBI_0000325 obo:IAO_0000111 "zip"@en ; obo:IAO_0000112 "MagicDraw MDZIP archive, Java JAR file."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "zip is a format standard of a digital entity that is conformant with the PKWARE .ZIP file format specification (http://www.pkware.com/index.php?option=com_content&task=view&id=59&Itemid=103/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.pkware.com/index.php?option=com_content&task=view&id=59&Itemid=103/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "zip"@en . obo:OBI_0000326 obo:IAO_0000111 "tar"@en ; obo:IAO_0000112 "Example.tar file."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "tar is a format standard of a digital entity that is conformant with the tape archive file format as standardized by POSIX.1-1998, POSIX.1-2001, or any other tar format compliant with the GNU tar specification. (http://www.gnu.org/software/tar/manual/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.gnu.org/software/tar/manual/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "tar"@en . obo:OBI_0000327 obo:IAO_0000111 "FCS"@en ; obo:IAO_0000112 "d01.fcs, FCS3 data file of well D06 of plate 2 of part 1 of a GvHD experiment."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "FCS is a format standard of a digital entity that is conformant with the Flow Cytometry Data File Standard.(http://www.fcspress.com/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.fcspress.com/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "FCS"@en . obo:OBI_0000329 obo:IAO_0000111 "Compensation-ML"@en ; obo:IAO_0000112 "compfoo.xml, Compensation-ML file describing compensation used in a GvHD experiment"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "Compensation-ML is a format standard of a digital entity that is conformant with the Compensation-ML standard. (http://wiki.ficcs.org/ficcs/Compensation-ML?action=AttachFile&do=get&target=Compensation-ML_v1.0.24.pdf)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://wiki.ficcs.org/ficcs/Compensation-ML?action=AttachFile&do=get&target=Compensation-ML_v1.0.24.pdf" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "Compensation-ML"@en . obo:OBI_0000330 obo:IAO_0000111 "Gating-ML"@en ; obo:IAO_0000112 "foogate.xml, Gating-ML file describing gates used in a GvHD experiment."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "Gating-ML is a format standard of a digital entity that is conformant with the Gating-ML standard. (http://www.flowcyt.org/gating/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.flowcyt.org/gating/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "Gating-ML"@en . obo:OBI_0000332 obo:IAO_0000111 "OWL"@en ; obo:IAO_0000112 "OBI ontology file, Basic Formal Ontology file, BIRNLex file, BioPAX file."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "OWL is a format standard of a digital entity that is conformant with the W3C Web Ontology Language specification.(http://www.w3.org/2004/OWL/)"@en ; obo:IAO_0000117 "person:Jennifer Fostel"@en ; obo:IAO_0000119 "web-page:http://www.w3.org/2004/OWL/" ; a obo:IAO_0000098, owl:NamedIndividual ; rdfs:label "OWL"@en . obo:OBI_0000417 obo:IAO_0000111 "achieves_planned_objective" ; obo:IAO_0000112 "A cell sorting process achieves the objective specification 'material separation objective'" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process." ; obo:IAO_0000117 "BP, AR, PPPB branch" ; obo:IAO_0000119 "PPPB branch derived" ; obo:IAO_0000232 "modified according to email thread from 1/23/09 in accordince with DT and PPPB branch" ; a owl:ObjectProperty ; rdfs:domain obo:OBI_0000011 ; rdfs:label "achieves_planned_objective" ; rdfs:range obo:IAO_0000005 ; owl:inverseOf obo:OBI_0000833 . obo:OBI_0000450 obo:IAO_0000111 "regulatory agency"@en ; obo:IAO_0000112 "The US Environmental Protection Agency" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A regulatory agency is a organization that has responsibility over or for the legislation (acts and regulations) for a given sector of the government."@en ; obo:IAO_0000117 "GROUP: OBI Biomaterial Branch" ; obo:IAO_0000119 "WEB: en.wikipedia.org/wiki/Regulator" ; a owl:Class ; rdfs:label "regulatory agency"@en ; rdfs:subClassOf obo:OBI_0000245, [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000014 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:OBI_0000245 [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000014 ] ) ] . obo:OBI_0000456 obo:IAO_0000111 "material transformation objective" ; obo:IAO_0000112 "The objective to create a mouse infected with LCM virus. The objective to create a defined solution of PBS." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "an objective specifiction that creates an specific output object from input materials."@en ; obo:IAO_0000117 "PERSON: Bjoern Peters", "PERSON: Frank Gibson", "PERSON: Jennifer Fostel", "PERSON: Melanie Courtot", "PERSON: Philippe Rocca-Serra" ; obo:IAO_0000118 "artifact creation objective"@en ; obo:IAO_0000119 "GROUP: OBI PlanAndPlannedProcess Branch" ; a owl:Class ; rdfs:label "material transformation objective"@en ; rdfs:subClassOf obo:IAO_0000005 . obo:OBI_0000457 obo:IAO_0000111 "manufacturing" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "Manufacturing is a process with the intent to produce a processed material which will have a function for future use. A person or organization (having manufacturer role) is a participant in this process"@en ; obo:IAO_0000116 "Manufacturing implies reproducibility and responsibility AR", "This includes a single scientist making a processed material for personal use."@en ; obo:IAO_0000117 "PERSON: Bjoern Peters", "PERSON: Frank Gibson", "PERSON: Jennifer Fostel", "PERSON: Melanie Courtot", "PERSON: Philippe Rocca-Serra" ; obo:IAO_0000119 "GROUP: OBI PlanAndPlannedProcess Branch" ; a owl:Class ; rdfs:label "manufacturing"@en ; rdfs:subClassOf obo:OBI_0000094, [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:BFO_0000040 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000458 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000458 ] . obo:OBI_0000458 obo:IAO_0000111 "manufacturing objective" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "is the objective to manufacture a material of a certain function (device)"@en ; obo:IAO_0000117 "PERSON: Bjoern Peters", "PERSON: Frank Gibson", "PERSON: Jennifer Fostel", "PERSON: Melanie Courtot", "PERSON: Philippe Rocca-Serra" ; obo:IAO_0000119 "GROUP: OBI PlanAndPlannedProcess Branch" ; a owl:Class ; rdfs:label "manufacturing objective"@en ; rdfs:subClassOf obo:OBI_0000456 . obo:OBI_0000462 obo:IAO_0000111 "Affymetrix" ; obo:IAO_0000112 "Affymetrix supplied microarray" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "An organization which supplies technology, tools and protocols for use in high throughput applications" ; a obo:OBI_0000835, obo:OBI_0002989, owl:NamedIndividual ; rdfs:label "Affymetrix" . obo:OBI_0000571 obo:IAO_0000111 "manufacturer role" ; obo:IAO_0000112 "With respect to The Accuri C6 Flow Cytometer System, the organization Accuri bears the role manufacturer role. With respect to a transformed line of tissue culture cells derived by a specific lab, the lab whose personnel isolated the cll line bears the role manufacturer role. With respect to a specific antibody produced by an individual scientist, the scientist who purifies, characterizes and distributes the anitbody bears the role manufacturer role." ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "Manufacturer role is a role which inheres in a person or organization and which is realized by a manufacturing process." ; obo:IAO_0000117 "GROUP: Role Branch" ; obo:IAO_0000119 "OBI" ; a owl:Class ; rdfs:label "manufacturer role" ; rdfs:subClassOf obo:BFO_0000023, [ a owl:Restriction ; owl:onProperty obo:RO_0000052 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:NCBITaxon_9606 obo:OBI_0000245 ) ] ], [ a owl:Restriction ; owl:allValuesFrom obo:OBI_0000457 ; owl:onProperty obo:BFO_0000054 ] . obo:OBI_0000639 obo:IAO_0000111 "material separation objective" ; obo:IAO_0000112 "The objective to obtain multiple aliquots of an enzyme preparation. The objective to obtain cells contained in a sample of blood." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "is an objective to transform a material entity into spatially separated components." ; obo:IAO_0000117 "PPPB branch" ; obo:IAO_0000119 "PPPB branch" ; a owl:Class ; rdfs:label "material separation objective" ; rdfs:subClassOf obo:OBI_0000456 ; owl:equivalentClass [ a owl:Class ; owl:unionOf (obo:OBI_0000678 obo:OBI_0000681 ) ] . obo:OBI_0000643 obo:IAO_0000111 "has grain" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "the relation of the cells in the finger of the skin to the finger, in which an indeterminate number of grains are parts of the whole by virtue of being grains in a collective that is part of the whole, and in which removing one granular part does not nec- essarily damage or diminish the whole. Ontological Whether there is a fixed, or nearly fixed number of parts - e.g. fingers of the hand, chambers of the heart, or wheels of a car - such that there can be a notion of a single one being missing, or whether, by contrast, the number of parts is indeterminate - e.g., cells in the skin of the hand, red cells in blood, or rubber molecules in the tread of the tire of the wheel of the car." ; obo:IAO_0000116 "Discussion in Karslruhe with, among others, Alan Rector, Stefan Schulz, Marijke Keet, Melanie Courtot, and Alan Ruttenberg. Definition take from the definition of granular parthood in the cited paper. Needs work to put into standard form"@en ; obo:IAO_0000117 "PERSON: Alan Ruttenberg"@en ; obo:IAO_0000119 "PAPER: Granularity, scale and collectivity: When size does and does not matter, Alan Rector, Jeremy Rogers, Thomas Bittner, Journal of Biomedical Informatics 39 (2006) 333-349" ; a owl:ObjectProperty ; rdfs:label "has grain" ; rdfs:subPropertyOf obo:BFO_0000051 . obo:OBI_0000648 obo:IAO_0000111 "clustered data set" ; obo:IAO_0000112 "A clustered data set is the output of a K means clustering data transformation" ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A data set that is produced as the output of a class discovery data transformation and consists of a data set with assigned discovered class labels."@en ; obo:IAO_0000117 "PERSON: James Malone", "PERSON: Monnie McGee" ; obo:IAO_0000118 "data set with assigned discovered class labels" ; obo:IAO_0000232 "AR thinks could be a data item instead" ; a owl:Class ; rdfs:label "clustered data set"@en ; rdfs:subClassOf obo:IAO_0000100, [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0200175 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0200175 ] . obo:OBI_0000659 obo:IAO_0000111 "specimen collection process" ; obo:IAO_0000112 "drawing blood from a patient for analysis, collecting a piece of a plant for depositing in a herbarium, buying meat from a butcher in order to measure its protein content in an investigation" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A planned process with the objective of collecting a specimen." ; obo:IAO_0000116 "Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation.", "Philly2013: A specimen collection can have as part a material entity acquisition, such as ordering from a bank. The distinction is that specimen collection necessarily involves the creation of a specimen role. However ordering cell lines cells from ATCC for use in an investigation is NOT a specimen collection, because the cell lines already have a specimen role.", "Philly2013: The specimen_role for the specimen is created during the specimen collection process.", """label changed to 'specimen collection process' on 10/27/2014, details see tracker: http://sourceforge.net/p/obi/obi-terms/716/""" ; obo:IAO_0000117 "Bjoern Peters" ; obo:IAO_0000118 "specimen collection" ; obo:IAO_0000232 "5/31/2012: This process is not necessarily an acquisition, as specimens may be collected from materials already in posession", "6/9/09: used at workshop" ; a owl:Class ; rdfs:label "specimen collection process" ; rdfs:subClassOf obo:OBI_0000011, [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:BFO_0000040 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0100051 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000684 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:OBI_0000011 [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000684 ] ) ] . obo:OBI_0000663 obo:IAO_0000111 "class prediction data transformation"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A class prediction data transformation (sometimes called supervised classification) is a data transformation that has objective class prediction."@en ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000118 "supervised classification data transformation" ; obo:IAO_0000119 "PERSON: James Malone"@en ; a owl:Class ; rdfs:label "class prediction data transformation"@en ; rdfs:subClassOf obo:OBI_0200000 ; owl:equivalentClass [ a owl:Class ; owl:unionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0000023 ] [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200179 ] ) ] . obo:OBI_0000678 obo:IAO_0000111 "portioning objective" ; obo:IAO_0000112 "The objective to obtain multiple aliquots of an enzyme preparation." ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A material separation objective aiming to separate material into multiple portions, each of which contains a similar composition of the input material." ; a owl:Class ; rdfs:label "portioning objective" ; rdfs:subClassOf obo:OBI_0000639 ; owl:disjointWith obo:OBI_0000681 . obo:OBI_0000681 obo:IAO_0000111 "separation into different composition objective" ; obo:IAO_0000112 "The objective to obtain cells contained in a sample of blood." ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A material separation objective aiming to separate a material entity that has parts of different types, and end with at least one output that is a material with parts of fewer types (modulo impurities)." ; obo:IAO_0000116 "We should be using has the grain relations or concentrations to distinguish the portioning and other sub-objectives" ; a owl:Class ; rdfs:label "separation into different composition objective" ; rdfs:subClassOf obo:OBI_0000639 . obo:OBI_0000684 obo:IAO_0000111 "specimen collection objective" ; obo:IAO_0000112 "The objective to collect bits of excrement in the rainforest. The objective to obtain a blood sample from a patient." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A objective specification to obtain a material entity for potential use as an input during an investigation." ; obo:IAO_0000117 "Bjoern Peters" ; obo:IAO_0000119 "Bjoern Peters" ; a owl:Class ; rdfs:label "specimen collection objective" ; rdfs:subClassOf obo:IAO_0000005 . obo:OBI_0000700 obo:IAO_0000111 "support vector machine" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A support vector machine is a data transformation with a class prediction objective based on the construction of a separating hyperplane that maximizes the margin between two data sets of vectors in n-dimensional space." ; obo:IAO_0000117 "James Malone", "Ryan Brinkman" ; obo:IAO_0000118 "SVM" ; obo:IAO_0000119 "PERSON: Ryan Brinkman" ; a owl:Class ; rdfs:label "support vector machine" ; rdfs:subClassOf obo:OBI_0000663, [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200179 ] . obo:OBI_0000704 obo:IAO_0000111 "decision tree induction objective" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A decision tree induction objective is a data transformation objective in which a tree-like graph of edges and nodes is created and from which the selection of each branch requires that some type of logical decision is made." ; obo:IAO_0000117 "James Malone" ; a owl:Class ; rdfs:label "decision tree induction objective" ; rdfs:subClassOf obo:OBI_0200166 . obo:OBI_0000707 obo:IAO_0000111 "decision tree building data transformation"@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A decision tree building data transformation is a data transformation that has objective decision tree induction."@en ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000119 "PERSON: James Malone"@en ; a owl:Class ; rdfs:label "decision tree building data transformation"@en ; rdfs:subClassOf obo:OBI_0200000, [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000704 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000704 ] . obo:OBI_0000713 obo:IAO_0000111 "GenePattern software" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "a software that provides access to more than 100 tools for gene expression analysis, proteomics, SNP analysis and common data processing tasks." ; obo:IAO_0000117 "James Malone", "Person:Helen Parkinson" ; obo:IAO_0000119 "WEB: http://www.broadinstitute.org/cancer/software/genepattern/" ; a owl:Class ; rdfs:label "GenePattern software" ; rdfs:subClassOf obo:IAO_0000010 . obo:OBI_0000726 obo:IAO_0000111 "peak matching" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "Peak matching is a data transformation performed on a dataset of a graph of ordered data points (e.g. a spectrum) with the objective of pattern matching local maxima above a noise threshold" ; obo:IAO_0000117 "James Malone", "Ryan Brinkman" ; obo:IAO_0000119 "PERSON: Ryan Brinkman" ; a owl:Class ; rdfs:label "peak matching" ; rdfs:subClassOf obo:OBI_0200000 . obo:OBI_0000727 obo:IAO_0000111 "k-nearest neighbors"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A k-nearest neighbors is a data transformation which achieves a class discovery or partitioning objective, in which an input data object with vector y is assigned to a class label based upon the k closest training data set points to y; where k is the largest value that class label is assigned."@en ; obo:IAO_0000117 "James Malone"@en ; obo:IAO_0000118 "k-NN" ; obo:IAO_0000119 "PERSON: James Malone"@en ; a owl:Class ; rdfs:label "k-nearest neighbors"@en ; rdfs:subClassOf obo:APOLLO_SV_00000796, obo:OBI_0200171, obo:OBI_0200175, [ a owl:Class ; owl:intersectionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0000648 ] [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200178 ] ) ] . obo:OBI_0000749 obo:IAO_0000111 "CART"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A CART (classification and regression trees) is a data transformation method for producing a classification or regression model with a tree-based structure."@en ; obo:IAO_0000117 "James Malone"@en ; obo:IAO_0000118 "classification and regression trees" ; obo:IAO_0000119 "BOOK: David J. Hand, Heikki Mannila and Padhraic Smyth (2001) Principles of Data Mining."@en ; a owl:Class ; rdfs:label "CART"@en ; rdfs:subClassOf obo:OBI_0000707 . obo:OBI_0000752 obo:IAO_0000111 "Thermo" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Thermo" . obo:OBI_0000753 obo:IAO_0000111 "Waters" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Waters" . obo:OBI_0000754 obo:IAO_0000111 "BIO-RAD" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "BIO-RAD" . obo:OBI_0000755 obo:IAO_0000111 "GenePattern hierarchical clustering" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "James Malone" ; a obo:OBI_0200042, owl:NamedIndividual ; rdfs:label "GenePattern hierarchical clustering" . obo:OBI_0000756 obo:IAO_0000111 "Ambion" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Ambion" . obo:OBI_0000757 obo:IAO_0000111 "Helicos" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Helicos" . obo:OBI_0000758 obo:IAO_0000111 "Roche" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Roche" . obo:OBI_0000759 obo:IAO_0000111 "Illumina" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Illumina" . obo:OBI_0000760 obo:IAO_0000111 "GenePattern PCA" ; obo:IAO_0000114 obo:IAO_0000123 ; a obo:OBI_0200051, owl:NamedIndividual ; rdfs:label "GenePattern PCA" . obo:OBI_0000761 obo:IAO_0000111 "GenePattern module SVM" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "GenePattern module SVM is a GenePattern software module which is used to run a support vector machine data transformation." ; obo:IAO_0000117 "James Malone", "Ryan Brinkman" ; obo:IAO_0000136 obo:OBI_0000775 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module SVM" . obo:OBI_0000762 obo:IAO_0000111 "GenePattern k-nearest neighbors" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "James Malone" ; a obo:OBI_0000727, owl:NamedIndividual ; rdfs:label "GenePattern k-nearest neighbors" . obo:OBI_0000763 obo:IAO_0000111 "GenePattern LOOCV" ; obo:IAO_0000114 obo:IAO_0000123 ; a obo:OBI_0200033, owl:NamedIndividual ; rdfs:label "GenePattern LOOCV" . obo:OBI_0000764 obo:IAO_0000111 "GenePattern k-means clustering" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "James Malone" ; a obo:OBI_0200041, owl:NamedIndividual ; rdfs:label "GenePattern k-means clustering" . obo:OBI_0000765 obo:IAO_0000111 "Agilent" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Agilent" . obo:OBI_0000766 obo:IAO_0000111 "GenePattern module KMeansClustering" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "GenePattern module KMeansClustering is a GenePattern software module which is used to perform a k Means clustering data transformation." ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000119 "PERSON: James Malone" ; obo:IAO_0000136 obo:OBI_0000764 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module KMeansClustering" . obo:OBI_0000767 obo:IAO_0000111 "GenePattern CART" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "James Malone" ; a obo:OBI_0000749, owl:NamedIndividual ; rdfs:label "GenePattern CART" . obo:OBI_0000768 obo:IAO_0000111 "GenePattern module CARTXValidation" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "GenePattern module CARTXValidation is a GenePattern software module which uses a CART decision tree induction with a leave one out cross validation data transformations." ; obo:IAO_0000136 obo:OBI_0000763, obo:OBI_0000767 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module CARTXValidation" . obo:OBI_0000769 obo:IAO_0000111 "Li-Cor" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Li-Cor" . obo:OBI_0000770 obo:IAO_0000111 "Bruker Corporation" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Bruker Corporation" . obo:OBI_0000771 obo:IAO_0000111 "GenePattern module KNNXValidation" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "GenePattern module KNNXValidation is a GenePattern software module which uses a k-nearest neighbours clustering with a leave one out cross validation data transformations." ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000119 "PERSON: James Malone" ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module KNNXValidation" . obo:OBI_0000772 obo:IAO_0000111 "GenePattern module PeakMatch" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000136 obo:OBI_0000778 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module PeakMatch" . obo:OBI_0000773 obo:IAO_0000111 "GenePattern module KNN" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "GenePattern module KNN is a GenePattern software module which perform a k-nearest neighbors data transformation." ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000136 obo:OBI_0000762 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module KNN" . obo:OBI_0000774 obo:IAO_0000111 "GenePattern module HierarchicalClustering" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "GenePattern module HierarchicalClustering is a GenePattern software module which is used to perform a hierarchical clustering data transformation." ; obo:IAO_0000117 "James Malone", "PERSON: James Malone" ; obo:IAO_0000136 obo:OBI_0000755 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module HierarchicalClustering" . obo:OBI_0000775 obo:IAO_0000111 "GenePattern SVM" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "James Malone" ; a obo:OBI_0000700, owl:NamedIndividual ; rdfs:label "GenePattern SVM" . obo:OBI_0000776 obo:IAO_0000111 "Applied Biosystems" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Applied Biosystems" . obo:OBI_0000777 obo:IAO_0000111 "GenePattern module PCA" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "GenePattern module PCA is a GenePattern software module which is used to perform a principal components analysis dimensionality reduction data transformation." ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000119 "PERSON: James Malone" ; obo:IAO_0000136 obo:OBI_0000760 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module PCA" . obo:OBI_0000778 obo:IAO_0000111 "GenePattern peak matching" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "James Malone", "Ryan Brinkman" ; a obo:OBI_0000726, owl:NamedIndividual ; rdfs:label "GenePattern peak matching" . obo:OBI_0000779 obo:IAO_0000111 "Bruker Daltonics" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Philippe Rocca-Serra" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Bruker Daltonics" . obo:OBI_0000780 obo:IAO_0000111 "GenePattern HeatMapViewer data visualization" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "The GenePattern process of generating Heat Maps from clustered data." ; obo:IAO_0000117 "James Malone" ; a obo:OBI_0200190, owl:NamedIndividual ; rdfs:label "GenePattern HeatMapViewer data visualization" . obo:OBI_0000781 obo:IAO_0000111 "GenePattern HierarchicalClusteringViewer data visualization" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "The GenePattern process of generating hierarchical clustering visualization from clustered data." ; obo:IAO_0000117 "James Malone" ; a obo:OBI_0200190, owl:NamedIndividual ; rdfs:label "GenePattern HierarchicalClusteringViewer data visualization" . obo:OBI_0000782 obo:IAO_0000111 "GenePattern module HeatMapViewer" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A GenePattern software module which is used to generate a heatmap view of data." ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000136 obo:OBI_0000780 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module HeatMapViewer" . obo:OBI_0000783 obo:IAO_0000111 "GenePattern module HierarchicalClusteringViewer" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A GenePattern software module which is used to generate a view of data that has been hierarchically clustered." ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000136 obo:OBI_0000781 ; a obo:OBI_0000713, owl:NamedIndividual ; rdfs:label "GenePattern module HierarchicalClusteringViewer" . obo:OBI_0000792 obo:IAO_0000111 "statistical model validation" ; obo:IAO_0000112 "Using the expression levels of 20 proteins to predict whether a cancer patient will respond to a drug. A practical goal would be to determine which subset of the 20 features should be used to produce the best predictive model. - wikipedia" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A data transformation which assesses how the results of a statistical analysis will generalize to an independent data set." ; obo:IAO_0000117 "Helen Parkinson" ; obo:IAO_0000119 "http://en.wikipedia.org/wiki/Cross-validation_%28statistics%29" ; a owl:Class ; rdfs:label "statistical model validation" ; rdfs:subClassOf obo:OBI_0200171, [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200188 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200188 ] . obo:OBI_0000806 obo:IAO_0000111 "material maintenance objective" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An objective specification maintains some or all of the qualities of a material over time." ; obo:IAO_0000117 "PERSON: Bjoern Peters" ; obo:IAO_0000119 "PERSON: Bjoern Peters" ; a owl:Class ; rdfs:label "material maintenance objective" ; rdfs:subClassOf obo:IAO_0000005 . obo:OBI_0000829 obo:IAO_0000111 "Sysmex Corporation, Kobe, Japan" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000119 "WEB:http://www.sysmex.com/@2009/08/06" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Sysmex Corporation, Kobe, Japan" . obo:OBI_0000833 obo:IAO_0000111 "objective_achieved_by" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process." ; obo:IAO_0000117 "OBI" ; obo:IAO_0000119 "OBI" ; a owl:ObjectProperty ; rdfs:domain obo:IAO_0000005 ; rdfs:label "objective_achieved_by" ; rdfs:range obo:OBI_0000011 . obo:OBI_0000835 obo:IAO_0000111 "manufacturer" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A person or organization that has a manufacturer role" ; a owl:Class ; rdfs:label "manufacturer" ; rdfs:subClassOf obo:BFO_0000040, [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000571 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf ([ a owl:Class ; owl:unionOf (obo:NCBITaxon_9606 obo:OBI_0000245 ) ] [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000571 ] ) ] . obo:OBI_0000838 obo:IAO_0000111 "material maintenance" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "a process with that achieves the objective to maintain some or all of the characteristics of an input material over time" ; a owl:Class ; rdfs:label "material maintenance" ; rdfs:subClassOf obo:OBI_0000011, [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000806 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000806 ] . obo:OBI_0000901 obo:IAO_0000111 "U.S. Food and Drug Administration" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000118 "FDA" ; a obo:OBI_0000450, owl:NamedIndividual ; rdfs:label "U.S. Food and Drug Administration" . obo:OBI_0000947 obo:IAO_0000111 "service provider role" ; obo:IAO_0000112 "Jackson Lab provides experimental animals, EBI provides training on databases, a core facility provides access to a DNA sequencer." ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "is a role which inheres in a person or organization and is realized in in a planned process which provides access to training, materials or execution of protocols for an organization or person" ; obo:IAO_0000117 "PERSON:Helen Parkinson" ; a owl:Class ; rdfs:label "service provider role" ; rdfs:subClassOf obo:BFO_0000023, [ a owl:Restriction ; owl:onProperty obo:RO_0000052 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:NCBITaxon_9606 obo:OBI_0000245 ) ] ], [ a owl:Restriction ; owl:allValuesFrom obo:OBI_0000011 ; owl:onProperty obo:BFO_0000054 ] . obo:OBI_0000953 obo:IAO_0000111 "processed specimen" ; obo:IAO_0000112 """A tissue sample that has been sliced and stained for a histology study. A blood specimen that has been centrifuged to obtain the white blood cells.""" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A specimen that has been intentionally physically modified." ; obo:IAO_0000117 "Bjoern Peters" ; obo:IAO_0000119 "Bjoern Peters" ; a owl:Class ; rdfs:comment "A tissue sample that has been sliced and stained for a histology study." ; rdfs:label "processed specimen" ; rdfs:subClassOf obo:OBI_0000047, obo:OBI_0100051 ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:OBI_0000047 obo:OBI_0100051 ) ] . obo:OBI_0000958 obo:IAO_0000111 "right handed" ; obo:IAO_0000114 obo:IAO_0000123 ; a obo:OBI_0000963, owl:NamedIndividual ; rdfs:label "right handed" . obo:OBI_0000963 obo:IAO_0000111 "categorical label" ; obo:IAO_0000112 "The labels 'positive' vs. 'negative', or 'left handed', 'right handed', 'ambidexterous', or 'strongly binding', 'weakly binding' , 'not binding', or '+++', '++', '+', '-' etc. form scales of categorical labels. " ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A label that is part of a categorical datum and that indicates the value of the data item on the categorical scale." ; obo:IAO_0000117 "Bjoern Peters" ; obo:IAO_0000119 "Bjoern Peters" ; a owl:Class ; rdfs:label "categorical label" ; rdfs:subClassOf obo:IAO_0000009 . obo:OBI_0000979 obo:IAO_0000111 "ambidexterous" ; obo:IAO_0000114 obo:IAO_0000123 ; a obo:OBI_0000963, owl:NamedIndividual ; rdfs:label "ambidexterous" . obo:OBI_0000998 obo:IAO_0000111 "left handed" ; obo:IAO_0000114 obo:IAO_0000123 ; a obo:OBI_0000963, owl:NamedIndividual ; rdfs:label "left handed" . obo:OBI_0001000 obo:IAO_0000111 "questionnaire" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A document with a set of printed or written questions with a choice of answers, devised for the purposes of a survey or statistical study."@en ; obo:IAO_0000116 """JT: It plays a role in collecting data that could be fleshed out more; but I'm thinking it is, in itself, an edited document. JZ: based on textual definition of edited document, it can be defined as N&S. I prefer to leave questionnaire as a document now. We can add more restrictions in the future and use that to determine it is an edited document or not. """@en, "Need to clarify if this is a document or a directive information entity (or what their connection is))" ; obo:IAO_0000117 "PERSON: Jessica Turner"@en ; obo:IAO_0000119 "Merriam-Webster"@en ; a owl:Class ; rdfs:label "questionnaire" ; rdfs:subClassOf obo:IAO_0000310 . obo:OBI_0001004 obo:IAO_0000111 "Edingburgh handedness inventory" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "The Edinburgh Handedness Inventory is a set of questions used to assess the dominance of a person's right or left hand in everyday activities. "@en ; obo:IAO_0000117 "PERSON:Alan Ruttenberg", "PERSON:Jessica Turner" ; obo:IAO_0000119 "PMID:5146491#Oldfield, R.C. (1971). The assessment and analysis of handedness: The Edinburgh inventory. Neuropsychologia, 9, 97-113", "WEB:http://www.cse.yorku.ca/course_archive/2006-07/W/4441/EdinburghInventory.html" ; a obo:OBI_0001000, owl:NamedIndividual ; rdfs:label "Edingburgh handedness inventory" . obo:OBI_0001213 obo:IAO_0000111 "eBioscience" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.ebioscience.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "eBioscience" . obo:OBI_0001224 obo:IAO_0000111 "Cytopeia" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.cytopeia.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Cytopeia" . obo:OBI_0001287 obo:IAO_0000111 "Exalpha Biological" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.exalpha.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Exalpha Biological" . obo:OBI_0001312 obo:IAO_0000111 "Apogee Flow Systems" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.apogeeflow.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Apogee Flow Systems" . obo:OBI_0001320 obo:IAO_0000111 "Exbio Antibodies" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.exbio.cz/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Exbio Antibodies" . obo:OBI_0001321 obo:IAO_0000111 "Becton Dickinson (BD Biosciences)" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.bdbiosciences.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Becton Dickinson (BD Biosciences)" . obo:OBI_0001338 obo:IAO_0000111 "Dako Cytomation" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.dakousa.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Dako Cytomation" . obo:OBI_0001340 obo:IAO_0000111 "Millipore" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.guavatechnologies.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Millipore" . obo:OBI_0001347 obo:IAO_0000111 "Antigenix" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.antigenix.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Antigenix" . obo:OBI_0001355 obo:IAO_0000111 "Partec" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.partec.de/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Partec" . obo:OBI_0001372 obo:IAO_0000111 "Beckman Coulter" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.beckmancoulter.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Beckman Coulter" . obo:OBI_0001375 obo:IAO_0000111 "Advanced Instruments Inc. (AI Companies)" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.aicompanies.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Advanced Instruments Inc. (AI Companies)" . obo:OBI_0001424 obo:IAO_0000111 "Miltenyi Biotec" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.miltenyibiotec.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Miltenyi Biotec" . obo:OBI_0001428 obo:IAO_0000111 "AES Chemunex" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.aeschemunex.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "AES Chemunex" . obo:OBI_0001431 obo:IAO_0000111 "Bentley Instruments" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://bentleyinstruments.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Bentley Instruments" . obo:OBI_0001434 obo:IAO_0000111 "Invitrogen" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.invitrogen.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Invitrogen" . obo:OBI_0001443 obo:IAO_0000111 "Luminex" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.luminexcorp.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Luminex" . obo:OBI_0001458 obo:IAO_0000111 "CytoBuoy" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000117 "Karin Breuer" ; obo:IAO_0000119 "WEB:http://www.cytobuoy.com/@2011/04/11" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "CytoBuoy" . obo:OBI_0001855 obo:IAO_0000111 "Nimblegen" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "An organization that focuses on manufacturing target enrichment probe pools for DNA sequencing." ; obo:IAO_0000117 "Person: Jie Zheng" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Nimblegen" . obo:OBI_0001856 obo:IAO_0000111 "Pacific Biosciences" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "An organization that supplies tools for studying the synthesis and regulation of DNA, RNA and protein. It developed a powerful technology platform called single molecule real-time (SMRT) technology which enables real-time analysis of biomolecules with single molecule resolution." ; obo:IAO_0000117 "Person: Jie Zheng" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Pacific Biosciences" . obo:OBI_0001860 obo:IAO_0000111 "NanoString Technologies" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "An organization that supplies life science tools for translational research and molecular diagnostics based on a novel digital molecular barcoding technology. The NanoString platform can provide simple, multiplexed digital profiling of single molecules." ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "NanoString Technologies" . obo:OBI_0001866 obo:IAO_0000111 "secondary cultured cell" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A cultured cell that has been passaged or derives from a cell that has been passaged in culture. " ; obo:IAO_0000116 "The term 'secondary cell culture' is generally used in biological texts/protocols to refer to any culture following an initial passage. We include it here because there are often a number of passages between a primary culture and the establishment of a stable, homogenous cell line. Such cultures are considered to be 'secondary cultures' but not 'cell lines' during this intermediate passaging/selection period between their derivation from a 'primary cell culture' and derivation into a 'cell line', which is a more specific type of secondary culture." ; obo:IAO_0000117 "Person: Matthew Brush" ; obo:IAO_0000119 "PERSON: Matthew Brush" ; a owl:Class ; rdfs:comment "A secondary cultured cell has been passaged in culture or is a descendant of such a cell that is derived through propagation in culture." ; rdfs:label "secondary cultured cell" ; rdfs:subClassOf obo:CL_0000010, [ a owl:Class ; owl:unionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600037 ] [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600037 ] ] ) ], [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom obo:CL_0000001 ] . obo:OBI_0001867 obo:IAO_0000111 "establishing cell line" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "a process whereby a new type of cell line is created, either through passaging of a primary cell culture to relative genetic stability and compositional homogeneity, or through some experimental modification of an existing cell line to produce a new line with novel characteristics (e.g. immortalization or some other stable genetic modification, or selection of some defined subset)." ; obo:IAO_0000116 "2013-4-20 MHB: For cases of initial establilshment of a line from a primary culture, successive passaging and/or selection processes can confer increasing degrees of genetic stability and compositional homogeneity as compared to the input primary culture. Historically, many texts consider the first passage as the clearest point to define the beginning of a line. However, in practice it is more often that case that more than one passage, and possibly additional selective techniques, may be required before a culture is deemed to have sufficient stability and homogeneity to be considered cell line. This is the view taken in OBI. Regardless, what is important is that some intentional, experimental step has been taken to establish a more homogenous and stable culture that can be characterized and progatated over time." ; obo:IAO_0000117 "Person: Matthew Brush" ; obo:IAO_0000119 "PERSON:Matthew Brush" ; a owl:Class ; rdfs:label "establishing cell line" ; rdfs:subClassOf obo:OBI_0600036, [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:CLO_0000031 ] . obo:OBI_0001879 obo:IAO_0000111 "reagent"@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A biological or chemical entity that bears a reagent role in virtue of it being intended for application in a scientific technique to participate in (or have molecular parts that participate in) a chemical reaction that facilitates the generation of data about some distinct entity, or the generation of some distinct material specified output." ; obo:IAO_0000116 "2013-6-5 MHB: Clarifications regarding the distinction between reagetns and devices were made at the May 2013 Philly Workshop. Reagents are distinguished from devices that also participate in scientific techniques by the fact that reagents are chemical or biological in nature and necessarily participate in some chemical interaction or reaction during the realization of their experimental role. By contrast, devices do not participate in such chemical reactions/interactions. Note that there are cases where devices use reagent components during their operation, where the reagent-device distinction is less clear. For examples, see editor note on OBI:device." ; obo:IAO_0000117 "PERSON:Matthew Brush" ; obo:IAO_0000119 "PERSON:Matthew Brush" ; a owl:Class ; rdfs:comment """(copied from ReO) Reagents are distinguished from devices/instruments that also serve as facilitators in scientific techniques by the fact that reagents are chemical or biological in nature and necessarily participate in or have parts that participate in some chemical interaction or reaction during their intended participation in some technique. By contrast, devices do not participate in a chemical reaction/interaction during the technique. Reagents are distinguished from study subjects/evaluants in that study subjects and evaluants are that about which conclusions are drawn and knowledge is sought in an investigation - while reagents, by definition, are not. It should be noted, however, that reagent and study subject/evaluant roles can be borne by instances of the same type of material entity - but a given instance can only realize one of these roles in the execution of a given assay. For example, taq polymerase can bear a reagent role or an evaluant role. In a DNA sequencing assay aimed at generating sequence data about some plasmid, the reagent role of the taq polymerase is realized. In an assay to evaluate the quality of the taq polymerase itself, the evaluant/study subject role of the taq is realized, but not the reagent role since the taq is the subject about which data is generated. In regard to the statement that reagents are 'distinct' from the specified outputs of a technique: note that a reagent may be incorporated into a material output of a technique, as long as the IDENTITY of this output is distinct from that of the bearer of the reagent role. For example, dNTPs input into a PCR are reagents that become part of the material output of this technique, but this output has a new identity (ie that of a 'nucleic acid molecule') that is distinct from the identity of the dNTPs that comprise it. Similarly, a biotin molecule input into a cell labeling technique are reagents that become part of the specified output, but the identity of the output is that of some modified cell specimen which shares identity with the input unmodified cell specimen, and not with the biotin label. Thus, we see that an important criteria of 'reagent-ness' is that it is a facilitator, and not the primary focus of an investigation or material processing technique (ie not the specified subject/evaluant about which knowledge is sought, or the specified output material of the technique).""" ; rdfs:label "reagent"@en ; rdfs:subClassOf obo:OBI_0000047, [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000086 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:BFO_0000040 [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000086 ] ) ] . obo:OBI_0001905 obo:IAO_0000111 "secondary cultured cell population" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A cultured cell population that is derived through one or more passages in culture." ; obo:IAO_0000116 "The term 'secondary cell culture' is generally used in biological texts/protocols to refer to any culture of cells following an initial passage. We include it here because there are often a number of passages between a primary culture and the establishment of a stable, homogenous cell line. Such cultures are considered to be 'secondary cultures' but not 'cell lines' during this intermediate passaging/selection period between their derivation from a 'primary cell culture' and derivation into a 'cell line', which is a more specific type of secondary culture." ; obo:IAO_0000117 "PERSON:Matthew Brush" ; obo:IAO_0000118 "secondary cell culture sample" ; obo:IAO_0000119 "PERSON:Matthew Brush" ; a owl:Class ; rdfs:comment "The concept of a 'secondary cultured cell population' covers cell lines as well as cultured cell populations more immediately derived from a primary culture which have yet to achieve adequate genetic stability and compositional homogeneity to be considered a cell line. The extent of the collection of cells in a 'secondary cultured cell population' is restricted only in that all cell members must share a propagation history (ie be derived through a common lineage of passages from an initial culture). Secondary cultured cell populations can be under active culture, stored in a quiescent state for future use, or applied experimentally." ; rdfs:label "secondary cultured cell population" ; rdfs:subClassOf obo:OBI_0100060, [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600037 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000643 ; owl:someValuesFrom obo:OBI_0001866 ], [ a owl:Restriction ; owl:allValuesFrom obo:OBI_0001866 ; owl:onProperty obo:OBI_0000643 ] . obo:OBI_0001912 obo:IAO_0000111 "cell freezing medium" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A processed material that serves as a liquid vehicle for freezing cells for long term quiescent stroage, which contains chemicls needed to sustain cell viability across freeze-thaw cycles. " ; obo:IAO_0000117 "PERSON: Matthew Brush" ; a owl:Class ; rdfs:label "cell freezing medium"@en ; rdfs:subClassOf obo:OBI_0000047 . obo:OBI_0001930 obo:IAO_0000111 "categorical value specification" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A value specification that is specifies one category out of a fixed number of nominal categories" ; obo:IAO_0000117 "PERSON:Bjoern Peters" ; a owl:Class ; rdfs:label "categorical value specification" ; rdfs:subClassOf obo:OBI_0001933 . obo:OBI_0001933 obo:IAO_0000111 "value specification" ; obo:IAO_0000112 "The value of 'positive' in a classification scheme of \"positive or negative\"; the value of '20g' on the quantitative scale of mass." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An information content entity that specifies a value within a classification scheme or on a quantitative scale." ; obo:IAO_0000116 "This term is currently a descendant of 'information content entity', which requires that it 'is about' something. A value specification of '20g' for a measurement data item of the mass of a particular mouse 'is about' the mass of that mouse. However there are cases where a value specification is not clearly about any particular. In the future we may change 'value specification' to remove the 'is about' requirement." ; obo:IAO_0000117 "PERSON:Bjoern Peters" ; a owl:Class ; rdfs:label "value specification" ; rdfs:subClassOf obo:IAO_0000030 . obo:OBI_0002076 obo:IAO_0000111 "collection of specimens"@en ; obo:IAO_0000112 "Blood cells collected from multiple donors over the course of a study."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A material entity that has two or more specimens as its parts."@en ; obo:IAO_0000116 "Details see tracker: https://sourceforge.net/p/obi/obi-terms/778/" ; obo:IAO_0000117 "Person: Chris Stoeckert, Jie Zheng"@en ; obo:IAO_0000119 "OBIB, OBI" ; dce:source "Biobank" ; a owl:Class ; rdfs:label "collection of specimens"@en ; rdfs:subClassOf obo:BFO_0000040 ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:BFO_0000040 [ a owl:Restriction ; owl:allValuesFrom obo:OBI_0100051 ; owl:onProperty obo:RO_0002351 ] ) ] . obo:OBI_0002193 obo:IAO_0000111 "Thermo Fisher Scientific" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An organization that is an American multinational, biotechnology product development company, created in 2006 by the merger of Thermo Electron and Fisher Scientific." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Thermo_Fisher_Scientific" ; a obo:OBI_0000245, owl:NamedIndividual ; rdfs:label "Thermo Fisher Scientific" . obo:OBI_0002205 obo:IAO_0000111 "histologic grade according to AJCC 7th edition" ; obo:IAO_0000112 "G1:Well differentiated", "G4: Undifferentiated" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the American Joint Committee on Cancer (AJCC) 7th Edition grading system." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "histologic grade according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002206 obo:IAO_0000111 "G1: Well differentiated" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to AJCC 7th edition indicating that the tumor cells and the organization of the tumor tissue appear close to normal." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G1" ; obo:IAO_0000119 "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002205, owl:NamedIndividual ; rdfs:label "G1: Well differentiated" . obo:OBI_0002207 obo:IAO_0000111 "G2: Moderately differentiated" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to AJCC 7th edition indicating that the tumor cells are moderately differentiated and reflect an intermediate grade." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G2" ; obo:IAO_0000119 "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002205, owl:NamedIndividual ; rdfs:label "G2: Moderately differentiated" . obo:OBI_0002208 obo:IAO_0000111 "G3: Poorly differentiated" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to AJCC 7th edition indicating that the tumor cells are poorly differentiated and do not look like normal cells and tissue." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G3" ; obo:IAO_0000119 "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002205, owl:NamedIndividual ; rdfs:label "G3: Poorly differentiated" . obo:OBI_0002209 obo:IAO_0000111 "G4: Undifferentiated" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to AJCC 7th edition indicating that the tumor cells are undifferentiated and do not look like normal cells and tissue." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G4" ; obo:IAO_0000119 "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002205, owl:NamedIndividual ; rdfs:label "G4: Undifferentiated" . obo:OBI_0002210 obo:IAO_0000111 "histologic grade according to the Fuhrman Nuclear Grading System" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the Fuhrman Nuclear Grading System." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Histologic Grade (Fuhrman Nuclear Grading System)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "histologic grade according to the Fuhrman Nuclear Grading System" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002211 obo:IAO_0000111 "G1 (Fuhrman)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are round, uniform, approximately 10um and that nucleoli are inconspicuous or absent." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Grade 1" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002210, owl:NamedIndividual ; rdfs:label "G1 (Fuhrman)" . obo:OBI_0002212 obo:IAO_0000111 "G2 (Fuhrman)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are slightly irregular, approximately 15um and nucleoli are evident." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Grade 2" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002210, owl:NamedIndividual ; rdfs:label "G2 (Fuhrman)" . obo:OBI_0002213 obo:IAO_0000111 "G3 (Fuhrman)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are very irregular, approximately 20um and nucleoli large and prominent." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Grade 3" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002210, owl:NamedIndividual ; rdfs:label "G3 (Fuhrman)" . obo:OBI_0002214 obo:IAO_0000111 "G4 (Fuhrman)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei arei bizarre and multilobulated, 20um or greater and nucleoli are prominent and chromatin clumped." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Grade 4" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002210, owl:NamedIndividual ; rdfs:label "G4 (Fuhrman)" . obo:OBI_0002215 obo:IAO_0000111 "histologic grade for ovarian tumor" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a histologic grade assigned to a ovarian tumor." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "histologic grade for ovarian tumor" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002216 obo:IAO_0000111 "histologic grade for ovarian tumor according to a two-tier grading system" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor that is from a two-tier histological classification of tumors. " ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "histologic grade for ovarian tumor according to a two-tier grading system" ; rdfs:subClassOf obo:OBI_0002215 . obo:OBI_0002217 obo:IAO_0000111 "Low grade ovarian tumor" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is low grade." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Low grade" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002216, owl:NamedIndividual ; rdfs:label "Low grade ovarian tumor" . obo:OBI_0002218 obo:IAO_0000111 "High grade ovarian tumor" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is high grade." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "High grade" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002216, owl:NamedIndividual ; rdfs:label "High grade ovarian tumor" . obo:OBI_0002219 obo:IAO_0000111 "histologic grade for ovarian tumor according to the World Health Organization" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor that is from a histological classification by the World Health Organization (WHO)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "histologic grade for ovarian tumor according to the World Health Organization" ; rdfs:subClassOf obo:OBI_0002215 . obo:OBI_0002220 obo:IAO_0000111 "G1 (WHO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is well differentiated." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G1" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002219, owl:NamedIndividual ; rdfs:label "G1 (WHO)" . obo:OBI_0002221 obo:IAO_0000111 "G2 (WHO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is moderately differentiated." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G2" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002219, owl:NamedIndividual ; rdfs:label "G2 (WHO)" . obo:OBI_0002222 obo:IAO_0000111 "G3 (WHO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is poorly differentiated." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G3" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002219, owl:NamedIndividual ; rdfs:label "G3 (WHO)" . obo:OBI_0002223 obo:IAO_0000111 "G4 (WHO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is undifferentiated." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "G4" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002219, owl:NamedIndividual ; rdfs:label "G4 (WHO)" . obo:OBI_0002224 obo:IAO_0000111 "pathologic primary tumor stage for colon and rectum according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pT: Pathologic spread colorectal primary tumor (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic primary tumor stage for colon and rectum according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002225 obo:IAO_0000111 "pT0 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that there is no evidence of primary tumor." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002224, owl:NamedIndividual ; rdfs:label "pT0 (colon)" . obo:OBI_0002226 obo:IAO_0000111 "pTis (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating carcinoma in situ (intraepithelial or invasion of lamina propria)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002224, owl:NamedIndividual ; rdfs:label "pTis (colon)" . obo:OBI_0002227 obo:IAO_0000111 "pT1 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades submucosa." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002224, owl:NamedIndividual ; rdfs:label "pT1 (colon)" . obo:OBI_0002228 obo:IAO_0000111 "pT2 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades muscularis propria." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002224, owl:NamedIndividual ; rdfs:label "pT2 (colon)" . obo:OBI_0002229 obo:IAO_0000111 "pT3 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades subserosa or into non-peritionealized pericolic or perirectal tissues." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002224, owl:NamedIndividual ; rdfs:label "pT3 (colon)" . obo:OBI_0002230 obo:IAO_0000111 "pT4a (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor perforates visceral peritoneum." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002224, owl:NamedIndividual ; rdfs:label "pT4a (colon)" . obo:OBI_0002231 obo:IAO_0000111 "pT4b (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor directly invades other organs or structures." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002224, owl:NamedIndividual ; rdfs:label "pT4b (colon)" . obo:OBI_0002232 obo:IAO_0000111 "pathologic primary tumor stage for lung according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pT: Pathologic spread lung primary tumor (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic primary tumor stage for lung according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002233 obo:IAO_0000111 "pT0 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that there is no evidence of primary tumor." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT0 (lung)" . obo:OBI_0002234 obo:IAO_0000111 "pTis (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating carcinoma in situ." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pTis (lung)" . obo:OBI_0002235 obo:IAO_0000111 "pT1 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 3 cm or less in greatest dimension, surrounded by lung or visceral pleura without bronchoscopic evidence of invasion more proximal than the lobar bronchus (i.e., not in the main bronchus)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT1 (lung)" . obo:OBI_0002236 obo:IAO_0000111 "pT1a (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 2 cm or less in greatest dimension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT1a (lung)" . obo:OBI_0002237 obo:IAO_0000111 "pT1b (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 2 cm but not more than 3 cm in greatest dimension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT1b (lung)" . obo:OBI_0002238 obo:IAO_0000111 "pT2 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 7 cm or the tumor has any of the following features: involves main bronchus, 2 cm or more distal to the carina, invades visceral pleura, associated with atelectasis or obstructive pneumonitis that extends to the hilar region but does not involve the entire lung." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT2 (lung)" . obo:OBI_0002239 obo:IAO_0000111 "pT2a (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 5 cm in greatest dimension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT2a (lung)" . obo:OBI_0002240 obo:IAO_0000111 "pT2b (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 5 cm but not more than 7 cm in greatest dimension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT2b (lung)" . obo:OBI_0002241 obo:IAO_0000111 "pT3 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 7 cm or one that directly invades any of: parietal pleura, chest wall (including superior sulcus tumors), diaphragm, phrenic nerve, mediastinal pleura, parietal pericardiu or the tumor is in the main bronchus less than 2 cm distal to the carina but without involvement of the carina or there is associated atelectasis or obstructive pneumonitis of the entire lung or there is separate tumor nodule(s) in the same lobe as the primary." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT3 (lung)" . obo:OBI_0002242 obo:IAO_0000111 "pT4 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor of any size that invades any of the following: mediastinum, heart, great vessels, trachea, recurrent laryngeal nerve, esophagus, vertebral body, carina or there is separate tumor nodule(s) in a different ipsilateral lobe to that of the primary." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002232, owl:NamedIndividual ; rdfs:label "pT4 (lung)" . obo:OBI_0002243 obo:IAO_0000111 "pathologic primary tumor stage for kidney according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pT: Pathologic spread kidney primary tumor (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic primary tumor stage for kidney according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002244 obo:IAO_0000111 "pT0 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that there is no evidence of primary tumor." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT0 (kidney)" . obo:OBI_0002245 obo:IAO_0000111 "pT1 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 7 cm or less in greatest dimension and limited to the kidney." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT1 (kidney)" . obo:OBI_0002246 obo:IAO_0000111 "pT1a (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 4 cm or less." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT1a (kidney)" . obo:OBI_0002247 obo:IAO_0000111 "pT1b (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 4 cm but not more than 7 cm." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT1b (kidney)" . obo:OBI_0002248 obo:IAO_0000111 "pT2 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm in greatest dimension and limited to the kidney." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT2 (kidney)" . obo:OBI_0002249 obo:IAO_0000111 "pT2a (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm but not more than 10 cm." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT2a (kidney)" . obo:OBI_0002250 obo:IAO_0000111 "pT2b (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 10 cm and limited to the kidney." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT2b (kidney)" . obo:OBI_0002251 obo:IAO_0000111 "pT3 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor extends into major veins or perinephric tissues but not into the ipsilateral adrenal gland and not beyond the Gerota fascia." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT3 (kidney)" . obo:OBI_0002252 obo:IAO_0000111 "pT3a (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into the renal vein or its segmental (muscle containing) branches, or the tumor invades perirenal and/or renal sinus fat (peripelvic) fat but not beyond Gerota fascia." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT3a (kidney)" . obo:OBI_0002253 obo:IAO_0000111 "pT3b (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava below diaphragm." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT3b (kidney)" . obo:OBI_0002254 obo:IAO_0000111 "pT3c (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava above the diaphragm or Invades the wall of the vena cava." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT3c (kidney)" . obo:OBI_0002255 obo:IAO_0000111 "pT4 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor invades beyond Gerota fascia (including contiguous extension into the ipsilateral adrenal gland)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002243, owl:NamedIndividual ; rdfs:label "pT4 (kidney)" . obo:OBI_0002256 obo:IAO_0000111 "pathologic primary tumor stage for ovary according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pT: Pathologic spread ovarian primary tumor (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic primary tumor stage for ovary according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002257 obo:IAO_0000111 "pT0 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that there is no evidence of primary tumor." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT0 (ovary)" . obo:OBI_0002258 obo:IAO_0000111 "pT1 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to the ovaries (one or both)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT1 (ovary)" . obo:OBI_0002259 obo:IAO_0000111 "pT1a (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one ovary; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT1a (ovary)" . obo:OBI_0002260 obo:IAO_0000111 "pT1b (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to both ovaries; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT1b (ovary)" . obo:OBI_0002261 obo:IAO_0000111 "pT1c (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one or both ovaries with capsule ruptured, tumor on ovarian surface, or malignant cells in ascites or peritoneal washings." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT1c (ovary)" . obo:OBI_0002262 obo:IAO_0000111 "pT2 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with pelvic extension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT2 (ovary)" . obo:OBI_0002263 obo:IAO_0000111 "pT2a (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension and/or implants on uterus and/or tube(s) and no malignant cells in ascites or peritoneal washings." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT2a (ovary)" . obo:OBI_0002264 obo:IAO_0000111 "pT2b (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension to other pelvic tissues and no malignant cells in ascites or peritoneal washings." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT2b (ovary)" . obo:OBI_0002265 obo:IAO_0000111 "pT2c (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has pelvic extension with malignant cells in ascites or peritoneal washings." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT2c (ovary)" . obo:OBI_0002266 obo:IAO_0000111 "pT3 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with microscopically confirmed peritoneal metastasis outside the pelvis and/or regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT3 (ovary)" . obo:OBI_0002267 obo:IAO_0000111 "pT3a (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has microscopic peritoneal metastasis beyond pelvis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT3a (ovary)" . obo:OBI_0002268 obo:IAO_0000111 "pT3b (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has macroscopic peritoneal, metastatasis beyond pelvis, 2 cm or less in greatest dimension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT3b (ovary)" . obo:OBI_0002269 obo:IAO_0000111 "pT3c (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has peritoneal metastasis beyond pelvis, more than 2 cm in greatest dimension and/or regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002256, owl:NamedIndividual ; rdfs:label "pT3c (ovary)" . obo:OBI_0002270 obo:IAO_0000111 "pathologic lymph node stage for colon and rectum according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pN: Pathologic spread colon lymph nodes (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic lymph node stage for colon and rectum according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002271 obo:IAO_0000111 "pN0 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating no regional lymph node metastsis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN0 (colon)" . obo:OBI_0002272 obo:IAO_0000111 "pN1 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1-3 regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN1 (colon)" . obo:OBI_0002273 obo:IAO_0000111 "pN1a (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1 regional lymph node." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN1a (colon)" . obo:OBI_0002274 obo:IAO_0000111 "pN1b (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 2-3 regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN1b (colon)" . obo:OBI_0002275 obo:IAO_0000111 "pN1c (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating tumor deposit(s), i.e., satellites in the subserosa, or in non-peritonealized pericolic or perirectal soft tissue without regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN1c (colon)" . obo:OBI_0002276 obo:IAO_0000111 "pN2 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 or more regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN2 (colon)" . obo:OBI_0002277 obo:IAO_0000111 "pN2a (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 to 6 regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN2a (colon)" . obo:OBI_0002278 obo:IAO_0000111 "pN2b (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 7 or more regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002270, owl:NamedIndividual ; rdfs:label "pN2b (colon)" . obo:OBI_0002279 obo:IAO_0000111 "pathologic lymph node stage for lung according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pN: Pathologic spread colon lymph nodes (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic lymph node stage for lung according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002280 obo:IAO_0000111 "pN0 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for lung according to AJCC 7th edition indicating no regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002279, owl:NamedIndividual ; rdfs:label "pN0 (lung)" . obo:OBI_0002281 obo:IAO_0000111 "pN1 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral peribronchial and/or ipsilateral hilar lymph nodes and intrapulmonary nodes, including involvement by direct extension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002279, owl:NamedIndividual ; rdfs:label "pN1 (lung)" . obo:OBI_0002282 obo:IAO_0000111 "pN2 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral mediastinal and/or subcarinal lymph node(s)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002279, owl:NamedIndividual ; rdfs:label "pN2 (lung)" . obo:OBI_0002283 obo:IAO_0000111 "pN3 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in contralateral mediastinal, contralateral hilar, ipsilateral or contralateral scalene, or supraclavicular lymph node(s)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002279, owl:NamedIndividual ; rdfs:label "pN3 (lung)" . obo:OBI_0002284 obo:IAO_0000111 "pathologic lymph node stage for kidney according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pN: Pathologic spread kidney lymph nodes (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic lymph node stage for kidney according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002285 obo:IAO_0000111 "pN0 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is no regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002284, owl:NamedIndividual ; rdfs:label "pN0 (kidney)" . obo:OBI_0002286 obo:IAO_0000111 "pN1 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002284, owl:NamedIndividual ; rdfs:label "pN1 (kidney)" . obo:OBI_0002287 obo:IAO_0000111 "pathologic lymph node stage for ovary according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "pN: Pathologic spread ovarian lymph nodes (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic lymph node stage for ovary according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002288 obo:IAO_0000111 "pN0 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is no regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002287, owl:NamedIndividual ; rdfs:label "pN0 (ovary)" . obo:OBI_0002289 obo:IAO_0000111 "pN1 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is regional lymph node metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_n/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002287, owl:NamedIndividual ; rdfs:label "pN1 (ovary)" . obo:OBI_0002290 obo:IAO_0000111 "pathologic distant metastases stage for colon according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of colon cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "M: colon distant metastases (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic distant metastases stage for colon according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002291 obo:IAO_0000111 "cM0 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there are no symptoms or signs of distant metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging#Pathological_M_Categorization_.28cM_and_pM.29" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002290, owl:NamedIndividual ; rdfs:label "cM0 (colon)" . obo:OBI_0002292 obo:IAO_0000111 "cM1 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is clinical evidence of distant metastases by history, physical examination, imaging studies, or invasive procedures, but without microscopic evidence of the presumed distant metastases." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging#Pathological_M_Categorization_.28cM_and_pM.29" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002290, owl:NamedIndividual ; rdfs:label "cM1 (colon)" . obo:OBI_0002293 obo:IAO_0000111 "cM1a (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ based on clinical assessment." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002290, owl:NamedIndividual ; rdfs:label "cM1a (colon)" . obo:OBI_0002294 obo:IAO_0000111 "cM1b (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum based on clinical assessment." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002290, owl:NamedIndividual ; rdfs:label "cM1b (colon)" . obo:OBI_0002295 obo:IAO_0000111 "pM1 (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is microscopic evidence confirming distant metastatic disease." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002290, owl:NamedIndividual ; rdfs:label "pM1 (colon)" . obo:OBI_0002296 obo:IAO_0000111 "pM1a (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ and histologically confirmed." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002290, owl:NamedIndividual ; rdfs:label "pM1a (colon)" . obo:OBI_0002297 obo:IAO_0000111 "pM1b (colon)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum and histologically confirmed." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002290, owl:NamedIndividual ; rdfs:label "pM1b (colon)" . obo:OBI_0002298 obo:IAO_0000111 "pathologic distant metastases stage for lung according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "M: lung distant metastases (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic distant metastases stage for lung according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002299 obo:IAO_0000111 "cM0 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is no distant metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002298, owl:NamedIndividual ; rdfs:label "cM0 (lung)" . obo:OBI_0002300 obo:IAO_0000111 "cM1 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002298, owl:NamedIndividual ; rdfs:label "cM1 (lung)" . obo:OBI_0002301 obo:IAO_0000111 "cM1a (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is based on clinical assessment and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002298, owl:NamedIndividual ; rdfs:label "cM1a (lung)" . obo:OBI_0002302 obo:IAO_0000111 "cM1b (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases based on clinical assessment." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002298, owl:NamedIndividual ; rdfs:label "cM1b (lung)" . obo:OBI_0002303 obo:IAO_0000111 "pM1 (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002298, owl:NamedIndividual ; rdfs:label "pM1 (lung)" . obo:OBI_0002304 obo:IAO_0000111 "pM1a (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is histologically confirmed and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002298, owl:NamedIndividual ; rdfs:label "pM1a (lung)" . obo:OBI_0002305 obo:IAO_0000111 "pM1b (lung)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed and associated with distant lymph nodes or carcinomatosis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002298, owl:NamedIndividual ; rdfs:label "pM1b (lung)" . obo:OBI_0002306 obo:IAO_0000111 "pathologic distant metastases stage for kidney according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "M: kidney distant Metastases (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic distant metastases stage for kidney according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002307 obo:IAO_0000111 "cM0 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is no distant metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002306, owl:NamedIndividual ; rdfs:label "cM0 (kidney)" . obo:OBI_0002308 obo:IAO_0000111 "cM1 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002306, owl:NamedIndividual ; rdfs:label "cM1 (kidney)" . obo:OBI_0002309 obo:IAO_0000111 "pM1 (kidney)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002306, owl:NamedIndividual ; rdfs:label "pM1 (kidney)" . obo:OBI_0002310 obo:IAO_0000111 "pathologic distant metastases stage for ovary according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "M: ovarian distant metastases (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "pathologic distant metastases stage for ovary according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002311 obo:IAO_0000111 "cM0 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is no distant metastasis." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002310, owl:NamedIndividual ; rdfs:label "cM0 (ovary)" . obo:OBI_0002312 obo:IAO_0000111 "cM1 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis based on clinical assessment." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002310, owl:NamedIndividual ; rdfs:label "cM1 (ovary)" . obo:OBI_0002313 obo:IAO_0000111 "pM1 (ovary)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis that is histologically confirmed." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002310, owl:NamedIndividual ; rdfs:label "pM1 (ovary)" . obo:OBI_0002314 obo:IAO_0000111 "clinical tumor stage group according to AJCC 7th edition" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is an assessment of the stage of a cancer according to the American Joint Committee on Cancer (AJCC) v7 staging systems." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Clinical tumor stage group (AJCC 7th Edition)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "clinical tumor stage group according to AJCC 7th edition" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002315 obo:IAO_0000111 "Occult Carcinoma (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating a small carcinoma, either asymptomatic or giving rise to metastases without symptoms due to the primary carcinoma." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Occult Carcinoma" ; obo:IAO_0000119 "http://www.medilexicon.com/dictionary/14371" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Occult Carcinoma (AJCC 7th)" . obo:OBI_0002316 obo:IAO_0000111 "Stage 0 (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating a carcinoma in situ (or melanoma in situ for melanoma of the skin or germ cell neoplasia in situ for testicular germ cell tumors) and generally is considered to have no metastatic potential. " ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 0" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage 0 (AJCC 7th)" . obo:OBI_0002317 obo:IAO_0000111 "Stage I (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers that are smaller or less deeply invasive without regional disease or nodes." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage I" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage I (AJCC 7th)" . obo:OBI_0002318 obo:IAO_0000111 "Stage IIA (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIB and IIC." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIA" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IIA (AJCC 7th)" . obo:OBI_0002319 obo:IAO_0000111 "Stage IIB (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIC." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIB" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IIB (AJCC 7th)" . obo:OBI_0002320 obo:IAO_0000111 "Stage IIC (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIB." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIC" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IIC (AJCC 7th)" . obo:OBI_0002321 obo:IAO_0000111 "Stage IIIA (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIB and IIIC." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIIA" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IIIA (AJCC 7th)" . obo:OBI_0002322 obo:IAO_0000111 "Stage IIIB (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIC." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIIB" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IIIB (AJCC 7th)" . obo:OBI_0002323 obo:IAO_0000111 "Stage IIIC (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIB." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIIC" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IIIC (AJCC 7th)" . obo:OBI_0002324 obo:IAO_0000111 "Stage IVA (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVB." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IVA" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IVA (AJCC 7th)" . obo:OBI_0002325 obo:IAO_0000111 "Stage IVB (AJCC 7th)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVA." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IVB" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002314, owl:NamedIndividual ; rdfs:label "Stage IVB (AJCC 7th)" . obo:OBI_0002326 obo:IAO_0000111 "International Federation of Gynecology and Obstetrics cervical cancer stage value specification" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is an assessment of the stage of a gynecologic cancer according to the International Federation of Gynecology and Obstetrics (FIGO) staging systems." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Clinical FIGO stage" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "International Federation of Gynecology and Obstetrics cervical cancer stage value specification" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002327 obo:IAO_0000111 "Stage IA (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating invasive carcinoma which can be diagnosed only by microscopy, with deepest invasion <5 mm and the largest extension <7 mm." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IA" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IA (FIGO)" . obo:OBI_0002328 obo:IAO_0000111 "Stage IA1 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of <3.0 mm in depth and extension of <7.0 mm." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IA1" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IA1 (FIGO)" . obo:OBI_0002329 obo:IAO_0000111 "Stage IA2 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of >3.0 mm and not >5.0 mm with an extension of not >7.0 mm." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IA2" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IA2 (FIGO)" . obo:OBI_0002330 obo:IAO_0000111 "Stage IB (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesions limited to the cervix uteri or pre-clinical cancers greater than stage IA" ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IB" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IB (FIGO)" . obo:OBI_0002331 obo:IAO_0000111 "Stage IB1 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA <4.0 cm in greatest dimension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IB1" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IB1 (FIGO)" . obo:OBI_0002332 obo:IAO_0000111 "Stage IB2 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA >4.0 cm in greatest dimension." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IB2" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IB2 (FIGO)" . obo:OBI_0002333 obo:IAO_0000111 "Stage IIA (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion. " ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIA" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IIA (FIGO)" . obo:OBI_0002334 obo:IAO_0000111 "Stage IIA1 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion <4.0 cm in greatest dimension. " ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIA1" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IIA1 (FIGO)" . obo:OBI_0002335 obo:IAO_0000111 "Stage IIA2 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion >4.0 cm in greatest dimension. " ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIA2" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IIA2 (FIGO)" . obo:OBI_0002336 obo:IAO_0000111 "Stage IIB (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina with obvious parametrial invasion. " ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIB" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IIB (FIGO)" . obo:OBI_0002337 obo:IAO_0000111 "Stage IIIA (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating tumour involves lower third of the vagina, with no extension to the pelvic wall." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIIA" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IIIA (FIGO)" . obo:OBI_0002338 obo:IAO_0000111 "Stage IIIB (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating extension to the pelvic wall and/or hydronephrosis or non-functioning kidney." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IIIB" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IIIB (FIGO)" . obo:OBI_0002339 obo:IAO_0000111 "Stage IVA (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread of the growth to adjacent organs." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IVA" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IVA (FIGO)" . obo:OBI_0002340 obo:IAO_0000111 "Stage IVB (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread to distant organs." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage IVB" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Cervical_cancer_staging" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002326, owl:NamedIndividual ; rdfs:label "Stage IVB (FIGO)" . obo:OBI_0002341 obo:IAO_0000111 "International Federation of Gynecology and Obstetrics ovarian cancer stage value specification" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the FIGO classification system." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Pathologic Tumor Stage Grouping for ovarian cancer (FIGO)" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "International Federation of Gynecology and Obstetrics ovarian cancer stage value specification" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002342 obo:IAO_0000111 "Stage 1 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 1" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 1 (FIGO)" . obo:OBI_0002343 obo:IAO_0000111 "Stage 1A (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1a, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 1A" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 1A (FIGO)" . obo:OBI_0002344 obo:IAO_0000111 "Stage 1B (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1b, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 1B" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 1B (FIGO)" . obo:OBI_0002345 obo:IAO_0000111 "Stage 1C (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1c, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 1C" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 1C (FIGO)" . obo:OBI_0002346 obo:IAO_0000111 "Stage 2 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 2" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 2 (FIGO)" . obo:OBI_0002347 obo:IAO_0000111 "Stage 2A (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2a, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 2A" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 2A (FIGO)" . obo:OBI_0002348 obo:IAO_0000111 "Stage 2B (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2b, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 2B" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 2B (FIGO)" . obo:OBI_0002349 obo:IAO_0000111 "Stage 2C (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2c, N0, and M0." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 2C" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 2C (FIGO)" . obo:OBI_0002350 obo:IAO_0000111 "Stage 3 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3, N0, and M0) or (T3,3a,3b, NX, and M0)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 3" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 3 (FIGO)" . obo:OBI_0002351 obo:IAO_0000111 "Stage 3A (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3a, N0, and M0 ." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 3A" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 3A (FIGO)" . obo:OBI_0002352 obo:IAO_0000111 "Stage 3B (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3b, N0, and M0 ." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 3B" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 3B (FIGO)" . obo:OBI_0002353 obo:IAO_0000111 "Stage 3C (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3c, N0,X and M0) or (any T, N1 and M0)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 3C" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 3C (FIGO)" . obo:OBI_0002354 obo:IAO_0000111 "Stage 4 (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of any T, any N, and M1." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage 4" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage 4 (FIGO)" . obo:OBI_0002355 obo:IAO_0000111 "Stage Unknown (FIGO)" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T0, N0, and M0) or (T1,1a-1c,2,2a-2c, NX, and M0) or (TX, N0,X, M0)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Stage Unknown" ; obo:IAO_0000119 "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002341, owl:NamedIndividual ; rdfs:label "Stage Unknown (FIGO)" . obo:OBI_0002356 obo:IAO_0000111 "performance status value specification" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A categorical value specification that is an assessment of a participant's performance status (general well-being and activities of daily life)." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Performance Status Scale" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Performance_status" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "performance status value specification" ; rdfs:subClassOf obo:OBI_0001930 . obo:OBI_0002357 obo:IAO_0000111 "Eastern Cooperative Oncology Group score value specification" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A performance status value specification designed by the Eastern Cooperative Oncology Group to assess disease progression and its affect on the daily living abilities of the patient." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "ECOG score" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "Eastern Cooperative Oncology Group score value specification" ; rdfs:subClassOf obo:OBI_0002356 . obo:OBI_0002358 obo:IAO_0000111 "3: symptomatic in bed more than 50% of the day but not bed ridden" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and in bed for more than 50% of the day but is not bed ridden." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002357, owl:NamedIndividual ; rdfs:label "3: symptomatic in bed more than 50% of the day but not bed ridden" . obo:OBI_0002359 obo:IAO_0000111 "2: symptomatic but in bed less than 50% of the day" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is in bed for less than 50% of the day." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002357, owl:NamedIndividual ; rdfs:label "2: symptomatic but in bed less than 50% of the day" . obo:OBI_0002360 obo:IAO_0000111 "4: bed ridden" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and is bed ridden." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002357, owl:NamedIndividual ; rdfs:label "4: bed ridden" . obo:OBI_0002361 obo:IAO_0000111 "0: asymptomatic" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An Eastern Cooperative Oncology Group score value specification indicating a patient is asymptomatic." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002357, owl:NamedIndividual ; rdfs:label "0: asymptomatic" . obo:OBI_0002362 obo:IAO_0000111 "1: symptomatic but fully ambulatory" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is fully ambulatory." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002357, owl:NamedIndividual ; rdfs:label "1: symptomatic but fully ambulatory" . obo:OBI_0002363 obo:IAO_0000111 "Karnofsky score vaue specification" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A performance status value specification designed for classifying patients 16 years of age or older by their functional impairment." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000118 "Karnofsky Score" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a owl:Class ; rdfs:label "Karnofsky score vaue specification" ; rdfs:subClassOf obo:OBI_0002356 . obo:OBI_0002364 obo:IAO_0000111 "100: asymptomatic" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A Karnofsky score vaue specification indicating that a patient is asymptomatic." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002363, owl:NamedIndividual ; rdfs:label "100: asymptomatic" . obo:OBI_0002365 obo:IAO_0000111 "80-90: symptomatic but fully ambulatory" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A Karnofsky score vaue specification indicating that a patient is symptomatic but fully ambulatory." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002363, owl:NamedIndividual ; rdfs:label "80-90: symptomatic but fully ambulatory" . obo:OBI_0002366 obo:IAO_0000111 "60-70: symptomatic but in bed less than 50% of the day" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A Karnofsky score vaue specification indicating that a patient is symptomatic but in bed less than 50% of the day." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002363, owl:NamedIndividual ; rdfs:label "60-70: symptomatic but in bed less than 50% of the day" . obo:OBI_0002367 obo:IAO_0000111 "40-50: symptomatic, in bed more than 50% of the day, but not bed ridden" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A Karnofsky score vaue specification indicating that a patient is symptomatic, in bed more than 50% of the day, but not bed ridden." ; obo:IAO_0000117 "Chris Stoeckert, Helena Ellis" ; obo:IAO_0000119 "NCI BBRB, OBI" ; obo:IAO_0000234 "NCI BBRB" ; a obo:OBI_0002363, owl:NamedIndividual ; rdfs:label "40-50: symptomatic, in bed more than 50% of the day, but not bed ridden" . obo:OBI_0002755 obo:IAO_0000111 "Oxford Nanopore Technologies" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An organization that is developing and selling nanopore sequencing products and is based in the UK." ; obo:IAO_0000117 "James A. Overton" ; obo:IAO_0000119 "https://en.wikipedia.org/wiki/Oxford_Nanopore_Technologies" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "Oxford Nanopore Technologies" . obo:OBI_0002903 obo:IAO_0000111 "BioGents" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "An organization that manufactures mosquito traps and other mosquito control products." ; obo:IAO_0000117 "John Judkins" ; obo:IAO_0000119 "WEB:https://eu.biogents.com/about-biogents/" ; a obo:OBI_0000835, owl:NamedIndividual ; rdfs:label "BioGents" . obo:OBI_0002989 obo:IAO_0000111 "material supplier" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A person or organization that provides material supplies to other people or organizations." ; obo:IAO_0000117 "Rebecca Jackson" ; obo:IAO_0000233 "https://github.com/obi-ontology/obi/issues/1289" ; a owl:Class ; rdfs:label "material supplier" ; rdfs:subClassOf obo:BFO_0000040, [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000018 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf ([ a owl:Class ; owl:unionOf (obo:NCBITaxon_9606 obo:OBI_0000245 ) ] [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000018 ] ) ] . obo:OBI_0100010 obo:IAO_0000111 "Epstein Barr virus transformed B cell"@en ; obo:IAO_0000112 "PMID: 8777380. Expression of thyroid peroxidase in EBV-transformed B cell lines using adenovirus.Thyroid. 1996 Feb;6(1):23-8."@en ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A material entity which results from viral transformation process using EBV as transformation agent when applied to B-cell entity"@en ; obo:IAO_0000117 "PERSON: Susanna Sansone" ; obo:IAO_0000119 "GROUP: OBI Biomaterial Branch" ; a owl:Class ; rdfs:label "Epstein Barr virus transformed B cell"@en ; rdfs:subClassOf obo:OBI_0000047, [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom [ a owl:Class ; owl:intersectionOf (obo:OBI_0600036 [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:NCBITaxon_10239 ] ) ] ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom [ a owl:Class ; owl:intersectionOf (obo:OBI_0600036 [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:NCBITaxon_10239 ] ) ] ] [ a owl:Restriction ; owl:allValuesFrom obo:CL_0000236 ; owl:onProperty obo:RO_0001000 ] ) ] . obo:OBI_0100026 obo:IAO_0000111 "organism"@en ; obo:IAO_0000112 "animal"@en, "fungus"@en, "plant"@en, "virus"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A material entity that is an individual living system, such as animal, plant, bacteria or virus, that is capable of replicating or reproducing, growth and maintenance in the right environment. An organism may be unicellular or made up, like humans, of many billions of cells divided into specialized tissues and organs."@en ; obo:IAO_0000116 "10/21/09: This is a placeholder term, that should ideally be imported from the NCBI taxonomy, but the high level hierarchy there does not suit our needs (includes plasmids and 'other organisms')", """13-02-2009: OBI doesn't take position as to when an organism starts or ends being an organism - e.g. sperm, foetus. This issue is outside the scope of OBI.""", "Stub class to serve as root of hierarchy for imports from NCBI Taxonomy." ; obo:IAO_0000117 "GROUP: OBI Biomaterial Branch" ; obo:IAO_0000119 "WEB: http://en.wikipedia.org/wiki/Organism"@en ; a owl:Class ; rdfs:label "organism", "organism"@en ; rdfs:subClassOf obo:GENO_0000904 ; owl:equivalentClass [ a owl:Class ; owl:unionOf (obo:NCBITaxon_10239 obo:NCBITaxon_2 obo:NCBITaxon_2157 obo:NCBITaxon_2759 ) ] . obo:OBI_0100051 obo:IAO_0000111 "specimen"@en ; obo:IAO_0000112 "Biobanking of blood taken and stored in a freezer for potential future investigations stores specimen." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A material entity that has the specimen role."@en ; obo:IAO_0000116 "Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation." ; obo:IAO_0000117 "PERSON: James Malone", "PERSON: Philippe Rocca-Serra" ; obo:IAO_0000119 "GROUP: OBI Biomaterial Branch"@en ; obo:IAO_0000233 ; a owl:Class ; rdfs:label "specimen"@en ; rdfs:subClassOf obo:BFO_0000040, [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000112 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:BFO_0000040 [ a owl:Restriction ; owl:onProperty obo:RO_0000087 ; owl:someValuesFrom obo:OBI_0000112 ] ) ] . obo:OBI_0100060 obo:IAO_0000111 "cultured cell population" ; obo:IAO_0000112 """A cultured cell population applied in an experiment: \"293 cells expressing TrkA were serum-starved for 18 hours and then neurotrophins were added for 10 min before cell harvest.\" (Lee, Ramee, et al. \"Regulation of cell survival by secreted proneurotrophins.\" Science 294.5548 (2001): 1945-1948). A cultured cell population maintained in vitro: \"Rat cortical neurons from 15 day embryos are grown in dissociated cell culture and maintained in vitro for 8–12 weeks\" (Dichter, Marc A. \"Rat cortical neurons in cell culture: culture methods, cell morphology, electrophysiology, and synapse formation.\" Brain Research 149.2 (1978): 279-293).""" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "A processed material comprised of a collection of cultured cells that has been continuously maintained together in culture and shares a common propagation history." ; obo:IAO_0000116 "2013-6-5 MHB: This OBI class was formerly called 'cell culture', but label changed and definition updated following CLO alignment efforts in spring 2013, during which the intent of this class was clarified to refer to portions of a culture or line rather than a complete cell culture or line."@en ; obo:IAO_0000117 "PERSON:Matthew Brush" ; obo:IAO_0000118 "cell culture sample" ; obo:IAO_0000119 "PERSON:Matthew Brush" ; a owl:Class ; rdfs:comment "The extent of a 'cultured cell population' is restricted only in that all cell members must share a propagation history (ie be derived through a common lineage of passages from an initial culture). In being defined in this way, this class can be used to refer to the populations that researchers actually use in the practice of science - ie are the inputs to culturing, experimentation, and sharing. The cells in such populations will be a relatively uniform population as they have experienced similar selective pressures due to their continuous co-propagation. And this population will also have a single passage number, again owing to their common passaging history. Cultured cell populations represent only a collection of cells (ie do not include media, culture dishes, etc), and include populations of cultured unicellular organisms or cultured multicellular organism cells. They can exist under active culture, stored in a quiescent state for future use, or applied experimentally." ; rdfs:label "cultured cell population" ; rdfs:subClassOf obo:OBI_0000047, [ a owl:Restriction ; owl:onProperty obo:OBI_0000312 ; owl:someValuesFrom obo:OBI_0600024 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000643 ; owl:someValuesFrom obo:CL_0000010 ], [ a owl:Restriction ; owl:allValuesFrom obo:CL_0000010 ; owl:onProperty obo:OBI_0000643 ] . obo:OBI_0200000 obo:IAO_0000111 "data transformation"@en ; obo:IAO_0000112 "The application of a clustering protocol to microarray data or the application of a statistical testing method on a primary data set to determine a p-value." ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A planned process that produces output data from input data."@en ; obo:IAO_0000117 "Elisabetta Manduchi"@en, "Helen Parkinson"@en, "James Malone"@en, "Melanie Courtot"@en, "Philippe Rocca-Serra", "Richard Scheuermann"@en, "Ryan Brinkman"@en, "Tina Hernandez-Boussard"@en ; obo:IAO_0000118 "data analysis"@en, "data processing"@en ; obo:IAO_0000119 "Branch editors"@en ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "data transformation"@en ; rdfs:subClassOf obo:OBI_0000011, [ a owl:Restriction ; owl:onProperty obo:BFO_0000055 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0000059 ; owl:someValuesFrom [ a owl:Class ; owl:intersectionOf (obo:IAO_0000064 [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:IAO_0000005 ] ) ] ] ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200166 ], [ a owl:Restriction ; owl:allValuesFrom obo:IAO_0000027 ; owl:onProperty obo:OBI_0000293 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200166 ] . obo:OBI_0200033 obo:IAO_0000111 "leave one out cross validation method"@en ; obo:IAO_0000112 "The authors conducted leave-one-out cross validation to estimate the strength and accuracy of the differentially expressed filtered genes. http://bioinformatics.oxfordjournals.org/cgi/content/abstract/19/3/368" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "is a data transformation : leave-one-out cross-validation (LOOCV) involves using a single observation from the original sample as the validation data, and the remaining observations as the training data. This is repeated such that each observation in the sample is used once as the validation data" ; obo:IAO_0000116 "2009-11-10. Tracker: https://sourceforge.net/tracker/?func=detail&aid=2893049&group_id=177891&atid=886178" ; obo:IAO_0000117 "Person:Helen Parkinson" ; a owl:Class ; rdfs:label "leave one out cross validation method"@en ; rdfs:subClassOf obo:OBI_0000792 . obo:OBI_0200041 obo:IAO_0000111 "k-means clustering"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A k-means clustering is a data transformation which achieves a class discovery or partitioning objective, which takes as input a collection of objects (represented as points in multidimensional space) and which partitions them into a specified number k of clusters. The algorithm attempts to find the centers of natural clusters in the data. The most common form of the algorithm starts by partitioning the input points into k initial sets, either at random or using some heuristic data. It then calculates the mean point, or centroid, of each set. It constructs a new partition by associating each point with the closest centroid. Then the centroids are recalculated for the new clusters, and the algorithm repeated by alternate applications of these two steps until convergence, which is obtained when the points no longer switch clusters (or alternatively centroids are no longer changed)."@en ; obo:IAO_0000117 "Elisabetta Manduchi", "James Malone"@en, "Philippe Rocca-Serra" ; obo:IAO_0000119 "WEB: http://en.wikipedia.org/wiki/K-means"@en ; a owl:Class ; rdfs:label "k-means clustering"@en ; rdfs:subClassOf obo:APOLLO_SV_00000796, obo:OBI_0200171, obo:OBI_0200175, [ a owl:Class ; owl:intersectionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0000648 ] [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200178 ] ) ] . obo:OBI_0200042 obo:IAO_0000111 "hierarchical clustering"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A hierarchical clustering is a data transformation which achieves a class discovery objective, which takes as input data item and builds a hierarchy of clusters. The traditional representation of this hierarchy is a tree (visualized by a dendrogram), with the individual input objects at one end (leaves) and a single cluster containing every object at the other (root)."@en ; obo:IAO_0000117 "James Malone"@en ; obo:IAO_0000119 "WEB: http://en.wikipedia.org/wiki/Data_clustering#Hierarchical_clustering"@en ; a owl:Class ; rdfs:label "hierarchical clustering"@en ; rdfs:subClassOf obo:APOLLO_SV_00000796, obo:OBI_0200175, [ a owl:Class ; owl:intersectionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0000648 ] [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200178 ] ) ] . obo:OBI_0200050 obo:IAO_0000111 "dimensionality reduction"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A dimensionality reduction is data partitioning which transforms each input m-dimensional vector (x_1, x_2, ..., x_m) into an output n-dimensional vector (y_1, y_2, ..., y_n), where n is smaller than m."@en ; obo:IAO_0000117 "Elisabetta Manduchi"@en, "James Malone"@en, "Melanie Courtot"@en, "Philippe Rocca-Serra" ; obo:IAO_0000118 "data projection" ; obo:IAO_0000119 "PERSON: Elisabetta Manduchi"@en, "PERSON: James Malone"@en, "PERSON: Melanie Courtot"@en ; a owl:Class ; rdfs:label "dimensionality reduction"@en ; rdfs:subClassOf obo:APOLLO_SV_00000796, obo:OBI_0200175, [ a owl:Class ; owl:intersectionOf (_:genid873 _:genid875 ) ] . obo:OBI_0200051 obo:IAO_0000111 "principal components analysis dimensionality reduction"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A principal components analysis dimensionality reduction is a dimensionality reduction achieved by applying principal components analysis and by keeping low-order principal components and excluding higher-order ones."@en ; obo:IAO_0000117 "Elisabetta Manduchi"@en, "James Malone"@en, "Melanie Courtot"@en, "Philippe Rocca-Serra" ; obo:IAO_0000118 "pca data reduction"@en ; obo:IAO_0000119 "PERSON: Elisabetta Manduchi"@en, "PERSON: James Malone"@en, "PERSON: Melanie Courtot"@en ; a owl:Class ; rdfs:label "principal components analysis dimensionality reduction"@en ; rdfs:subClassOf obo:OBI_0200050 . obo:OBI_0200111 obo:IAO_0000111 "data visualization" ; obo:IAO_0000112 "Generation of a heatmap from a microarray dataset" ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An planned process that creates images, diagrams or animations from the input data."@en ; obo:IAO_0000117 "Elisabetta Manduchi"@en, "James Malone"@en, "Melanie Courtot"@en, "Tina Boussard"@en ; obo:IAO_0000118 "data encoding as image", "visualization"@en ; obo:IAO_0000119 "PERSON: Elisabetta Manduchi"@en, "PERSON: James Malone"@en, "PERSON: Melanie Courtot"@en, "PERSON: Tina Boussard"@en ; obo:IAO_0000232 """Possible future hierarchy might include this: information_encoding >data_encoding >>image_encoding""" ; a owl:Class ; rdfs:label "data visualization"@en ; rdfs:subClassOf obo:OBI_0000011, [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:IAO_0000027 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:IAO_0000038 obo:IAO_0000101 ) ] ], [ a owl:Restriction ; owl:allValuesFrom obo:IAO_0000027 ; owl:onProperty obo:OBI_0000293 ], [ a owl:Restriction ; owl:allValuesFrom [ a owl:Class ; owl:unionOf (obo:IAO_0000038 obo:IAO_0000101 ) ] ; owl:onProperty obo:OBI_0000299 ] . obo:OBI_0200166 obo:IAO_0000111 "data transformation objective"@en ; obo:IAO_0000112 "normalize objective"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "An objective specification to transformation input data into output data"@en ; obo:IAO_0000116 "Modified definition in 2013 Philly OBI workshop" ; obo:IAO_0000117 "James Malone"@en ; obo:IAO_0000119 "PERSON: James Malone"@en ; a owl:Class ; rdfs:label "data transformation objective"@en ; rdfs:subClassOf obo:IAO_0000005 . obo:OBI_0200171 obo:IAO_0000111 "partitioning data transformation"@en ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A partitioning data transformation is a data transformation that has objective partitioning."@en ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000119 "PERSON: James Malone"@en ; a owl:Class ; rdfs:label "partitioning data transformation"@en ; rdfs:subClassOf obo:OBI_0200000, [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200172 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200172 ] . obo:OBI_0200172 obo:IAO_0000111 "partitioning objective"@en ; obo:IAO_0000112 "A k-means clustering which has partitioning objective is a data transformation in which the input data is partitioned into k output sets."@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A partitioning objective is a data transformation objective where the aim is to generate a collection of disjoint non-empty subsets whose union equals a non-empty input set."@en ; obo:IAO_0000117 "Elisabetta Manduchi", "James Malone"@en ; obo:IAO_0000119 "PERSON: Elisabetta Manduchi" ; a owl:Class ; rdfs:label "partitioning objective"@en ; rdfs:subClassOf obo:OBI_0200166 . obo:OBI_0200175 obo:IAO_0000111 "class discovery data transformation"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A class discovery data transformation (sometimes called unsupervised classification) is a data transformation that has objective class discovery."@en ; obo:IAO_0000117 "James Malone" ; obo:IAO_0000118 "clustering data transformation", "unsupervised classification data transformation" ; obo:IAO_0000119 "PERSON: James Malone"@en ; a owl:Class ; rdfs:label "class discovery data transformation"@en ; rdfs:subClassOf obo:OBI_0200000 ; owl:equivalentClass [ a owl:Class ; owl:unionOf ([ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0000648 ] [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0200178 ] ) ] . obo:OBI_0200178 obo:IAO_0000111 "class discovery objective"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "A class discovery objective (sometimes called unsupervised classification) is a data transformation objective where the aim is to organize input data (typically vectors of attributes) into classes, where the number of classes and their specifications are not known a priori. Depending on usage, the class assignment can be definite or probabilistic."@en ; obo:IAO_0000117 "James Malone"@en ; obo:IAO_0000118 "clustering objective", "discriminant analysis objective"@en, "unsupervised classification objective"@en ; obo:IAO_0000119 "PERSON: Elisabetta Manduchi", "PERSON: James Malone" ; a owl:Class ; rdfs:label "class discovery objective"@en ; rdfs:subClassOf obo:OBI_0200166 . obo:OBI_0200179 obo:IAO_0000111 "class prediction objective"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 """A class prediction objective (sometimes called supervised classification) is a data transformation objective where the aim is to create a predictor from training data through a machine learning technique. The training data consist of pairs of objects (typically vectors of attributes) and class labels for these objects. The resulting predictor can be used to attach class labels to any valid novel input object. Depending on usage, the prediction can be definite or probabilistic. A classification is learned from the training data and can then be tested on test data."""@en ; obo:IAO_0000117 "James Malone"@en ; obo:IAO_0000118 "classification objective", "supervised classification objective"@en ; obo:IAO_0000119 "PERSON: Elisabetta Manduchi", "PERSON: James Malone" ; a owl:Class ; rdfs:label "class prediction objective"@en ; rdfs:subClassOf obo:OBI_0200166 . obo:OBI_0200188 obo:IAO_0000111 "cross validation objective"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A cross validation objective is a data transformation objective in which the aim is to partition a sample of data into subsets such that the analysis is initially performed on a single subset, while the other subset(s) are retained for subsequent use in confirming and validating the initial analysis."@en ; obo:IAO_0000117 "James Malone"@en ; obo:IAO_0000118 "rotation estimation objective"@en ; obo:IAO_0000119 "WEB: http://en.wikipedia.org/wiki/Cross_validation" ; a owl:Class ; rdfs:label "cross validation objective"@en ; rdfs:subClassOf obo:OBI_0200172 . obo:OBI_0200190 obo:IAO_0000111 "clustered data visualization" ; obo:IAO_0000114 obo:IAO_0000123 ; obo:IAO_0000115 "A data visualization which has input of a clustered data set and produces an output of a report graph which is capable of rendering data of this type." ; obo:IAO_0000117 "James Malone" ; a owl:Class ; rdfs:label "clustered data visualization" ; rdfs:subClassOf obo:OBI_0200111, [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:IAO_0000037 obo:IAO_0000179 obo:IAO_0000180 obo:IAO_0000183 obo:IAO_0000184 ) ] ], [ a owl:Restriction ; owl:allValuesFrom obo:OBI_0000648 ; owl:onProperty obo:OBI_0000293 ] . obo:OBI_0600014 obo:IAO_0000111 "material component separation"@en ; obo:IAO_0000112 "Using a cell sorter to separate a mixture of T cells into two fractions; one with surface receptor CD8 and the other lacking the receptor, or purification"@en ; obo:IAO_0000114 obo:IAO_0000122 ; obo:IAO_0000115 "a material processing in which components of an input material become segregated in space"@en ; obo:IAO_0000117 "Bjoern Peters"@en ; obo:IAO_0000119 "IEDB"@en ; a owl:Class ; rdfs:label "material component separation"@en ; rdfs:subClassOf obo:OBI_0000094, [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:BFO_0000040 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000639 ] ; owl:equivalentClass [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000639 ] . obo:OBI_0600024 obo:IAO_0000111 "maintaining cell culture"@en ; obo:IAO_0000112 "When harvesting blood from a human, isolating T cells, and then limited dilution cloning of the cells, the maintaining_cell_culture step comprises all steps after the initial dilution and plating of the cells into culture, e.g. placing the culture into an incubator, changing or adding media, and splitting a cell culture"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "a protocol application in which cells are kept alive in a defined environment outside of an organism. part of cell_culturing"@en ; obo:IAO_0000117 "PlanAndPlannedProcess Branch"@en ; obo:IAO_0000119 "OBI branch derived"@en ; a owl:Class ; rdfs:label "maintaining cell culture"@en ; rdfs:subClassOf obo:OBI_0000838, [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:OBI_0100060 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:OBI_0000079 obo:OBI_0001912 ) ] ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0100060 ] . obo:OBI_0600036 obo:IAO_0000111 "'establishing cell culture'" ; obo:IAO_0000114 obo:IAO_0000120 ; obo:IAO_0000115 "a process through which a new type of cell culture or cell line is created, either through the isolation and culture of one or more cells from a fresh source, or the deliberate experimental modification of an existing cell culture (e.g passaging a primary culture to become a secondary culture or line, or the immortalization or stable genetic modification of an existing culture or line)." ; obo:IAO_0000117 "PERSON:Matthew Brush" ; obo:IAO_0000119 "PERSON:Matthew Brush" ; a owl:Class ; rdfs:comment "A 'cell culture' as used here referes to a new lineage of cells in culture deriving from a single biological source.. New cultures are established through the initial isolation and culturing of cells from an organismal source, or through changes in an existing cell culture or line that result in a new culture with unique characteristics. This can occur through the passaging/selection of a primary culture into a secondary culture or line, or experimental modifications of an existing cell culture or line such as an immortalization process or other stable genetic modification. This class covers establishment of cultures of either multicellular organism cells or unicellular organisms." ; rdfs:label "establishing cell culture" ; rdfs:subClassOf obo:OBI_0000094, [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:CL_0000000 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:OBI_0000079 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0100060 ] . obo:OBI_0600037 obo:IAO_0000111 "cell culture splitting"@en ; obo:IAO_0000112 "The act of taking a cell culture of high density, counting the cells, removing part of the cells, and re-seeding a select number of the cells into new flasks with fresh tissue culture media."@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "The act of taking part of a homogeneous cell culture and creating one or more additional separate cultures of similar qualities. input: cell_culture, output cell_culture min cardinality 2. part of cell culturing"@en ; obo:IAO_0000117 "PlanAndPlannedProcess Branch"@en ; obo:IAO_0000118 "cell culture passaging" ; obo:IAO_0000119 "OBI branch derived"@en ; a owl:Class ; rdfs:comment "An active cell culture is typically split when it has grown to confluence in its culture dish. Cell culture splitting of a cell culture sample results in an increase in its passage number, which measures how long a sample has been propagated in vitro, and therefore how many selective or genetic changes it is likely to have undergone." ; rdfs:label "cell culture splitting"@en ; rdfs:subClassOf obo:OBI_0600014, [ a owl:Restriction ; owl:onProperty obo:OBI_0000293 ; owl:someValuesFrom obo:OBI_0100060 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000299 ; owl:someValuesFrom obo:OBI_0100060 ], [ a owl:Restriction ; owl:onProperty obo:OBI_0000417 ; owl:someValuesFrom obo:OBI_0000678 ] . obo:OGMS_0000031 obo:IAO_0000115 "A disposition (i) to undergo pathological processes that (ii) exists in an organism because of one or more disorders in that organism."@en ; a owl:Class ; rdfs:label "disease" ; rdfs:subClassOf obo:BFO_0000016 . obo:OMO_0001000 obo:IAO_0000115 "The term was added to the ontology on the assumption it was in scope, but it turned out later that it was not."@en ; obo:IAO_0000116 "This obsolesence reason should be used conservatively. Typical valid examples are: un-necessary grouping classes in disease ontologies, a phenotype term added on the assumption it was a disease."@en ; obo:IAO_0000117 ; obo:IAO_0000233 "https://github.com/information-artifact-ontology/ontology-metadata/issues/77" ; obo:IAO_0000234 "https://orcid.org/0000-0001-5208-3432" ; a obo:IAO_0000225, owl:NamedIndividual ; rdfs:label "out of scope" . obo:OMO_0001001 obo:IAO_0000115 "This is an annotation used on an object property to indicate a logical characterstic beyond what is possible in OWL." ; obo:IAO_0000119 "OBO Operations call" ; oboInOwl:created_by ; a owl:AnnotationProperty ; rdfs:label "logical characteristic of object property" . obo:OMO_0002000 obo:IAO_0000112 """'part disjoint with' 'defined by construct' \"\"\" PREFIX owl: PREFIX : ; dce:contributor , ; a owl:AnnotationProperty ; rdfs:label "defined by construct" . obo:PATO_0000001 obo:IAO_0000115 "A dependent entity that inheres in a bearer by virtue of how the bearer is related to other entities" ; a owl:Class ; rdfs:label "quality" ; rdfs:subClassOf obo:BFO_0000020 . obo:PATO_0000016 obo:IAO_0000116 "'Value' label chosen here according to http://www.uwgb.edu/heuerc/2D/ColorTerms.html", "Was parent of chromosomal band intensity before moving this class to live as a sequence feature attribute." ; obo:IAO_0000118 "color value" ; a owl:Class ; rdfs:label "obsolete color brightness" ; owl:deprecated true . obo:PATO_0000047 obo:IAO_0000111 "biological sex" ; obo:IAO_0000115 "An organismal quality inhering in a bearer by virtue of the bearer's ability to undergo sexual reproduction in order to differentiate the individuals or types involved." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "biological sex" ; rdfs:subClassOf obo:PATO_0001995 . obo:PATO_0000383 obo:IAO_0000111 "female" ; obo:IAO_0000115 "A biological sex quality inhering in an individual or a population that only produces gametes that can be fertilised by male gametes." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "female" ; rdfs:subClassOf obo:PATO_0001894 . obo:PATO_0000384 obo:IAO_0000111 "male" ; obo:IAO_0000115 "A biological sex quality inhering in an individual or a population whose sex organs contain only male gametes." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "male" ; rdfs:subClassOf obo:PATO_0001894 . obo:PATO_0001241 obo:IAO_0000111 "physical object quality" ; obo:IAO_0000115 "A quality which inheres in a continuant." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "physical object quality" ; rdfs:subClassOf obo:BFO_0000019 . obo:PATO_0001894 obo:IAO_0000111 "phenotypic sex" ; obo:IAO_0000115 "An organismal quality inhering in a bearer by virtue of the bearer's physical expression of sexual characteristics." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "phenotypic sex", "phenotypic sex"@en ; rdfs:subClassOf obo:PATO_0000047 . obo:PATO_0001995 obo:IAO_0000111 "organismal quality" ; obo:IAO_0000115 "A quality that inheres in an entire organism or part of an organism." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "organismal quality" ; rdfs:subClassOf obo:PATO_0001241 . obo:PCO_0000000 obo:IAO_0000115 "A material entity that consists of two or more organisms, viruses, or viroids." ; a owl:Class ; rdfs:comment "A group of organisms of the same taxonomic group grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role)." ; rdfs:label "collection of organisms" ; rdfs:subClassOf obo:GENO_0000904, [ a owl:Restriction ; owl:onProperty obo:RO_0002351 ; owl:someValuesFrom obo:OBI_0100026 ] . obo:PCO_0000020 obo:IAO_0000115 "A domestic group, or a number of domestic groups linked through descent (demonstrated or stipulated) from a common ancestor, marriage, or adoption." ; a owl:Class ; rdfs:label "family" ; rdfs:subClassOf obo:PCO_0000000 . obo:RO_0000052 obo:IAO_0000111 "inheres in"@en ; obo:IAO_0000112 "this fragility inheres in this vase"@en, "this fragility is a characteristic of this vase"@en, "this red color inheres in this apple"@en, "this red color is a characteristic of this apple"@en ; obo:IAO_0000115 "a relation between a specifically dependent continuant (the characteristic) and any other entity (the bearer), in which the characteristic depends on the bearer for its existence."@en, "a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence", "a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A dependent inheres in its bearer at all times for which the dependent exists."@en ; obo:IAO_0000118 "inheres_in"@en ; obo:RO_0001900 obo:RO_0001901 ; a owl:FunctionalProperty, owl:ObjectProperty ; rdfs:label "characteristic of"@en, "inheres in"@en, "inheres_in" ; rdfs:subPropertyOf obo:RO_0002314 ; owl:inverseOf obo:RO_0000053 . obo:RO_0000053 obo:IAO_0000111 "bearer of"@en ; obo:IAO_0000112 "this apple is bearer of this red color"@en, "this vase is bearer of this fragility"@en ; obo:IAO_0000115 "Inverse of characteristic_of"@en, "a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence", "a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A bearer can have many dependents, and its dependents can exist for different periods of time, but none of its dependents can exist when the bearer does not exist."@en ; obo:IAO_0000118 "bearer_of"@en, "is bearer of"@en ; obo:RO_0001900 obo:RO_0001901 ; a owl:InverseFunctionalProperty, owl:ObjectProperty ; rdfs:label "bearer of"@en, "has characteristic"@en ; rdfs:range obo:BFO_0000020 . obo:RO_0000056 obo:IAO_0000111 "participates in"@en ; obo:IAO_0000112 "this blood clot participates in this blood coagulation"@en, "this input material (or this output material) participates in this process"@en, "this investigator participates in this investigation"@en ; obo:IAO_0000115 "a relation between a continuant and a process, in which the continuant is somehow involved in the process", "a relation between a continuant and a process, in which the continuant is somehow involved in the process"@en ; obo:IAO_0000118 "participates_in"@en ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000002 ; rdfs:label "participates in", "participates in"@en ; rdfs:range obo:BFO_0000003 ; owl:inverseOf obo:RO_0000057 . obo:RO_0000057 obo:IAO_0000111 "has participant"@en ; obo:IAO_0000112 "this blood coagulation has participant this blood clot"@en, "this investigation has participant this investigator"@en, "this process has participant this input material (or this output material)"@en ; obo:IAO_0000115 "a relation between a process and a continuant, in which the continuant is somehow involved in the process", "a relation between a process and a continuant, in which the continuant is somehow involved in the process"@en ; obo:IAO_0000116 "Has_participant is a primitive instance-level relation between a process, a continuant, and a time at which the continuant participates in some way in the process. The relation obtains, for example, when this particular process of oxygen exchange across this particular alveolar membrane has_participant this particular sample of hemoglobin at this particular time."@en ; obo:IAO_0000118 "has_participant"@en ; dce:source "http://www.obofoundry.org/ro/#OBO_REL:has_participant" ; dcterms:source "http://www.obofoundry.org/ro/#OBO_REL:has_participant" ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000003 ; rdfs:label "has participant", "has participant"@en ; rdfs:range obo:BFO_0000002 ; owl:propertyChainAxiom (obo:BFO_0000051 obo:RO_0000057 ) . obo:RO_0000058 obo:IAO_0000112 "A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The journal article (a generically dependent continuant) is concretized as the quality (a specifically dependent continuant), and both depend on that copy of the printed journal (an independent continuant)."@en, "An investigator reads a protocol and forms a plan to carry out an assay. The plan is a realizable entity (a specifically dependent continuant) that concretizes the protocol (a generically dependent continuant), and both depend on the investigator (an independent continuant). The plan is then realized by the assay (a process)."@en ; obo:IAO_0000115 "A relationship between a generically dependent continuant and a specifically dependent continuant or process, in which the generically dependent continuant depends on some independent continuant or process in virtue of the fact that the specifically dependent continuant or process also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants or processes."@en, "A relationship between a generically dependent continuant and a specifically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants."@en ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000031 ; rdfs:label "is concretized as"@en ; rdfs:range obo:BFO_0000020, [ a owl:Class ; owl:unionOf (obo:BFO_0000015 obo:BFO_0000020 ) ] ; owl:inverseOf obo:RO_0000059 . obo:RO_0000059 obo:IAO_0000112 "A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The quality (a specifically dependent continuant) concretizes the journal article (a generically dependent continuant), and both depend on that copy of the printed journal (an independent continuant).", "A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The quality (a specifically dependent continuant) concretizes the journal article (a generically dependent continuant), and both depend on that copy of the printed journal (an independent continuant)."@en, "An investigator reads a protocol and forms a plan to carry out an assay. The plan is a realizable entity (a specifically dependent continuant) that concretizes the protocol (a generically dependent continuant), and both depend on the investigator (an independent continuant). The plan is then realized by the assay (a process)."@en ; obo:IAO_0000115 "A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant.", "A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant."@en, "A relationship between a specifically dependent continuant or process and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant or process also depends on that same independent continuant. Multiple specifically dependent continuants or processes can concretize the same generically dependent continuant."@en ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000020, [ a owl:Class ; owl:unionOf (obo:BFO_0000015 obo:BFO_0000020 ) ] ; rdfs:label "concretizes"@en ; rdfs:range obo:BFO_0000031 . obo:RO_0000079 obo:IAO_0000112 "this catalysis function is a function of this enzyme"@en ; obo:IAO_0000115 "a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A function inheres in its bearer at all times for which the function exists, however the function need not be realized at all the times that the function exists."@en ; obo:IAO_0000118 "function_of"@en, "is function of"@en ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000034 ; rdfs:label "function of"@en ; rdfs:subPropertyOf obo:RO_0000052 ; owl:inverseOf obo:RO_0000085 . obo:RO_0000080 obo:IAO_0000112 "this red color is a quality of this apple"@en ; obo:IAO_0000115 "a relation between a quality and an independent continuant (the bearer), in which the quality specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A quality inheres in its bearer at all times for which the quality exists."@en ; obo:IAO_0000118 "is quality of"@en, "quality_of"@en ; a owl:ObjectProperty ; rdfs:label "quality of"@en ; rdfs:subPropertyOf obo:RO_0000052 ; owl:inverseOf obo:RO_0000086 . obo:RO_0000081 obo:IAO_0000112 "this investigator role is a role of this person"@en ; obo:IAO_0000115 "a relation between a role and an independent continuant (the bearer), in which the role specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A role inheres in its bearer at all times for which the role exists, however the role need not be realized at all the times that the role exists."@en ; obo:IAO_0000118 "is role of"@en, "role_of"@en ; a owl:ObjectProperty ; rdfs:label "role of"@en ; rdfs:subPropertyOf obo:RO_0000052 ; owl:inverseOf obo:RO_0000087 . obo:RO_0000085 obo:IAO_0000112 "this enzyme has function this catalysis function (more colloquially: this enzyme has this catalysis function)"@en ; obo:IAO_0000115 "a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A bearer can have many functions, and its functions can exist for different periods of time, but none of its functions can exist when the bearer does not exist. A function need not be realized at all the times that the function exists."@en ; obo:IAO_0000118 "has_function"@en ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000004 ; rdfs:label "has function"@en ; rdfs:range obo:BFO_0000034 ; rdfs:subPropertyOf obo:RO_0000053 . obo:RO_0000086 obo:IAO_0000112 "this apple has quality this red color"@en ; obo:IAO_0000115 "a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence", "a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A bearer can have many qualities, and its qualities can exist for different periods of time, but none of its qualities can exist when the bearer does not exist."@en ; obo:IAO_0000118 "has_quality"@en ; a owl:ObjectProperty ; rdfs:label "has quality", "has quality"@en ; rdfs:range obo:BFO_0000019 ; rdfs:subPropertyOf obo:RO_0000053 . obo:RO_0000087 obo:IAO_0000112 "this person has role this investigator role (more colloquially: this person has this role of investigator)"@en ; obo:IAO_0000115 "a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence"@en ; obo:IAO_0000116 "A bearer can have many roles, and its roles can exist for different periods of time, but none of its roles can exist when the bearer does not exist. A role need not be realized at all the times that the role exists."@en ; obo:IAO_0000118 "has_role"@en ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000004 ; rdfs:label "has role", "has role"@en ; rdfs:range obo:BFO_0000023 ; rdfs:subPropertyOf obo:RO_0000053 . obo:RO_0000091 obo:IAO_0000115 "a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence", "a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence"@en ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000004 ; rdfs:label "has disposition", "has disposition"@en ; rdfs:range obo:BFO_0000016 ; rdfs:subPropertyOf obo:RO_0000053 ; owl:inverseOf obo:RO_0000092 . obo:RO_0000092 obo:IAO_0000115 "inverse of has disposition" ; a owl:ObjectProperty ; rdfs:label "disposition of"@en ; rdfs:subPropertyOf obo:RO_0000052 . obo:RO_0001000 obo:IAO_0000111 "derives from" ; obo:IAO_0000112 "this cell derives from this parent cell (cell division)"@en, "this nucleus derives from this parent nucleus (nuclear division)"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en ; obo:IAO_0000116 "This is a very general relation. More specific relations are preferred when applicable, such as 'directly develops from'."@en ; obo:IAO_0000118 "derives_from"@en ; obo:IAO_0000412 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000004 ; rdfs:label "derives from", "derives from"@en ; rdfs:range obo:BFO_0000004 ; rdfs:subPropertyOf owl:topObjectProperty ; owl:inverseOf obo:RO_0001001 . obo:RO_0001001 obo:IAO_0000112 "this parent cell derives into this cell (cell division)"@en, "this parent nucleus derives into this nucleus (nuclear division)"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "a relation between two distinct material entities, the old entity and the new entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en ; obo:IAO_0000116 "This is a very general relation. More specific relations are preferred when applicable, such as 'directly develops into'. To avoid making statements about a future that may not come to pass, it is often better to use the backward-looking 'derives from' rather than the forward-looking 'derives into'."@en ; obo:IAO_0000118 "derives_into"@en ; a owl:ObjectProperty ; rdfs:label "derives into"@en . obo:RO_0001900 a owl:AnnotationProperty . obo:RO_0002013 obo:IAO_0000115 "A 'has regulatory component activity' B if A and B are GO molecular functions (GO_0003674), A has_component B and A is regulated by B." ; a owl:ObjectProperty ; rdfs:label "has regulatory component activity" ; rdfs:subPropertyOf obo:RO_0002017, obo:RO_0002334 . obo:RO_0002014 obo:IAO_0000115 "A relationship that holds between a GO molecular function and a component of that molecular function that negatively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is negatively regulated by B." ; a owl:ObjectProperty ; rdfs:label "has negative regulatory component activity" ; rdfs:subPropertyOf obo:RO_0002013, obo:RO_0002335 . obo:RO_0002015 obo:IAO_0000115 "A relationship that holds between a GO molecular function and a component of that molecular function that positively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is positively regulated by B." ; a owl:ObjectProperty ; rdfs:label "has positive regulatory component activity" ; rdfs:subPropertyOf obo:RO_0002013, obo:RO_0002336 . obo:RO_0002017 a owl:ObjectProperty ; rdfs:label "has component activity" ; rdfs:subPropertyOf obo:RO_0002018 . obo:RO_0002018 obo:IAO_0000115 "w 'has process component' p if p and w are processes, w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000015 ; rdfs:label "has component process" ; rdfs:range obo:BFO_0000015 ; rdfs:subPropertyOf obo:RO_0002180 . obo:RO_0002022 a owl:ObjectProperty ; rdfs:label "directly regulated by" ; rdfs:subPropertyOf obo:RO_0002334 ; owl:inverseOf obo:RO_0002578 . obo:RO_0002023 obo:IAO_0000115 "Process(P2) is directly negatively regulated by process(P1) iff: P1 negatively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding negatively regulates the kinase activity (P2) of protein B then P2 directly negatively regulated by P1." ; a owl:ObjectProperty ; rdfs:label "directly negatively regulated by" ; rdfs:subPropertyOf obo:RO_0002022 ; owl:inverseOf obo:RO_0002630 . obo:RO_0002024 obo:IAO_0000115 "Process(P2) is directly postively regulated by process(P1) iff: P1 positively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding positively regulates the kinase activity (P2) of protein B then P2 is directly postively regulated by P1." ; a owl:ObjectProperty ; rdfs:label "directly positively regulated by" ; rdfs:subPropertyOf obo:RO_0002022 ; owl:inverseOf obo:RO_0002629 . obo:RO_0002025 obo:IAO_0000115 "A 'has effector activity' B if A and B are GO molecular functions (GO_0003674), A 'has component activity' B and B is the effector (output function) of B. Each compound function has only one effector activity." ; a owl:FunctionalProperty, owl:ObjectProperty ; rdfs:label "has effector activity" ; rdfs:subPropertyOf obo:RO_0002017 . obo:RO_0002084 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "during which ends"@en ; rdfs:subPropertyOf obo:RO_0002222 ; owl:inverseOf obo:RO_0002093 . obo:RO_0002086 obo:IAO_0000117 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "ends after"@en ; rdfs:subPropertyOf obo:RO_0002222 ; owl:propertyChainAxiom (obo:RO_0002093 obo:BFO_0000062 ) . obo:RO_0002087 obo:IAO_0000117 ; obo:IAO_0000118 "starts_at_end_of" ; a owl:ObjectProperty ; rdfs:label "immediately preceded by"@en ; rdfs:subPropertyOf obo:BFO_0000062 ; owl:inverseOf obo:RO_0002090 . obo:RO_0002088 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "during which starts"@en ; rdfs:subPropertyOf obo:RO_0002222 ; owl:inverseOf obo:RO_0002091 . obo:RO_0002090 obo:IAO_0000117 ; obo:IAO_0000118 "ends_at_start_of", "meets" ; a owl:ObjectProperty ; rdfs:label "immediately precedes"@en ; rdfs:subPropertyOf obo:BFO_0000063 . obo:RO_0002091 obo:IAO_0000117 ; obo:IAO_0000118 "io" ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000003 ; rdfs:label "starts during", "starts during"@en ; rdfs:range obo:BFO_0000003 ; rdfs:subPropertyOf obo:RO_0002222 . obo:RO_0002093 obo:IAO_0000117 ; obo:IAO_0000118 "o", "overlaps" ; a owl:ObjectProperty ; rdfs:label "ends during", "ends during"@en ; rdfs:subPropertyOf obo:RO_0002222 . obo:RO_0002131 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "x overlaps y if and only if there exists some z such that x has part z and z part of y" ; a owl:ObjectProperty, owl:SymmetricProperty ; rdfs:label "overlaps"@en ; rdfs:subPropertyOf obo:RO_0002323 ; owl:propertyChainAxiom (obo:BFO_0000050 obo:BFO_0000050 ), (obo:BFO_0000051 obo:RO_0002131 ), (obo:RO_0002131 obo:BFO_0000050 ) . obo:RO_0002162 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed." ; obo:IAO_0000117 , ; obo:IAO_0000119 , ; oboInOwl:hasNarrowSynonym "life cycle stage of"@en ; a owl:ObjectProperty ; rdfs:label "in taxon", "in taxon"@en ; rdfs:range obo:OBI_0100026 ; rdfs:subPropertyOf obo:RO_0002320 ; owl:propertyChainAxiom (obo:RO_0002131 obo:RO_0002162 ), (obo:RO_0002211 obo:RO_0002162 ), (obo:RO_0002215 obo:RO_0002162 ), (obo:RO_0002254 obo:RO_0002162 ), (obo:RO_0002295 obo:RO_0002162 ), (obo:RO_0002387 obo:RO_0002162 ) . obo:RO_0002180 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "w 'has component' p if w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." ; obo:IAO_0000116 "The definition of 'has component' is still under discussion. The challenge is in providing a definition that does not imply transitivity." ; a owl:ObjectProperty ; rdfs:label "has component"@en ; rdfs:subPropertyOf obo:BFO_0000051 . obo:RO_0002200 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "A relationship that holds between a biological entity and a phenotype. Here a phenotype is construed broadly as any kind of quality of an organism part, a collection of these qualities, or a change in quality or qualities (e.g. abnormally increased temperature). The subject of this relationship can be an organism (where the organism has the phenotype, i.e. the qualities inhere in parts of this organism), a genomic entity such as a gene or genotype (if modifications of the gene or the genotype causes the phenotype), or a condition such as a disease (such that if the condition inheres in an organism, then the organism has the phenotype)." ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:domain [ a owl:Class ; owl:unionOf (obo:BFO_0000031 obo:OGMS_0000031 obo:UBERON_0000465 ) ] ; rdfs:label "has phenotype", "has phenotype"@en ; rdfs:range obo:UPHENO_0001001 ; rdfs:subPropertyOf obo:RO_0016001 ; owl:inverseOf obo:RO_0002201 . obo:RO_0002201 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "inverse of has phenotype" ; obo:IAO_0000117 ; a owl:FunctionalProperty, owl:ObjectProperty ; rdfs:domain obo:UPHENO_0001001 ; rdfs:label "phenotype of"@en . obo:RO_0002202 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "x develops from y if and only if either (a) x directly develops from y or (b) there exists some z such that x directly develops from z and z develops from y" ; obo:IAO_0000117 , , , ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:domain obo:BFO_0000004 ; rdfs:label "develops from"@en ; rdfs:range obo:BFO_0000004 ; rdfs:subPropertyOf obo:RO_0002254, obo:RO_0002258 ; owl:inverseOf obo:RO_0002203 . obo:RO_0002203 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "inverse of develops from" ; obo:IAO_0000117 , , ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "develops into"@en ; rdfs:subPropertyOf obo:RO_0002286, obo:RO_0002387, obo:RO_0002388 . obo:RO_0002211 obo:IAO_0000115 "p regulates q iff p is causally upstream of q, the execution of p is not constant and varies according to specific conditions, and p influences the rate or magnitude of execution of q due to an effect either on some enabler of q or some enabler of a part of q." ; obo:IAO_0000117 , , ; obo:IAO_0000119 , "GO" ; obo:IAO_0000600 false ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:domain obo:BFO_0000015 ; rdfs:label "regulates"@en ; rdfs:range obo:BFO_0000015 ; rdfs:subPropertyOf obo:RO_0002411 ; owl:inverseOf obo:RO_0002334 ; owl:propertyChainAxiom (obo:RO_0002211 obo:RO_0002025 ), (obo:RO_0002578 obo:RO_0002578 ) . obo:RO_0002212 obo:IAO_0000115 "p negatively regulates q iff p regulates q, and p decreases the rate or magnitude of execution of q." ; obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "negatively regulates"@en ; rdfs:subPropertyOf obo:RO_0002211, obo:RO_0002305 ; owl:inverseOf obo:RO_0002335 . obo:RO_0002213 obo:IAO_0000115 "p positively regulates q iff p regulates q, and p increases the rate or magnitude of execution of q." ; obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "positively regulates"@en ; rdfs:subPropertyOf obo:RO_0002211, obo:RO_0002304 ; owl:inverseOf obo:RO_0002336 ; owl:propertyChainAxiom (obo:RO_0002212 obo:RO_0002212 ) . obo:RO_0002215 obo:IAO_0000112 "mechanosensory neuron capable of detection of mechanical stimulus involved in sensory perception (GO:0050974)", "osteoclast SubClassOf 'capable of' some 'bone resorption'" ; obo:IAO_0000115 "A relation between a material entity (such as a cell) and a process, in which the material entity has the ability to carry out the process. " ; obo:IAO_0000117 ; obo:IAO_0000118 "has function realized in" ; obo:IAO_0000119 , ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000004 ; rdfs:label "capable of"@en ; rdfs:range obo:BFO_0000015 ; rdfs:subPropertyOf obo:RO_0002216 . obo:RO_0002216 obo:IAO_0000115 "c stands in this relationship to p if and only if there exists some p' such that c is capable_of p', and p' is part_of p." ; obo:IAO_0000117 ; obo:IAO_0000118 "has function in" ; a owl:ObjectProperty ; rdfs:label "capable of part of"@en ; rdfs:subPropertyOf obo:RO_0002328, obo:RO_0002500 . obo:RO_0002222 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000116 "move to BFO?" ; obo:IAO_0000117 ; obo:IAO_0000119 , "Allen" ; dcterms:source "https://docs.google.com/document/d/1kBv1ep_9g3sTR-SD3jqzFqhuwo9TPNF-l-9fUDbO6rM/edit?pli=1"^^xsd:anyURI ; a owl:ObjectProperty ; rdfs:comment "A relation that holds between two occurrents. This is a grouping relation that collects together all the Allen relations." ; rdfs:domain obo:BFO_0000003 ; rdfs:label "temporal relation"@en, "temporally related to"@en ; rdfs:range obo:BFO_0000003 . obo:RO_0002233 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "p has direct input c iff c is a participant in p, c is present at the start of p, and the state of c is modified during p.", "p has input c iff: p is a process, c is a material entity, c is a participant in p, c is present at the start of p, and the state of c is modified during p." ; obo:IAO_0000117 ; obo:IAO_0000118 "consumes" ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000015 ; rdfs:label "has input"@en ; rdfs:subPropertyOf obo:RO_0000057 ; owl:inverseOf obo:RO_0002352 . obo:RO_0002234 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "p has output c iff c is a participant in p, c is present at the end of p, and c is not present at the beginning of p.", "p has output c iff c is a participant in p, c is present at the end of p, and c is not present in the same state at the beginning of p." ; obo:IAO_0000117 ; obo:IAO_0000118 "produces" ; a owl:ObjectProperty ; rdfs:label "has output"@en ; rdfs:subPropertyOf obo:RO_0000057 ; owl:inverseOf obo:RO_0002353 . obo:RO_0002254 obo:IAO_0000112 "Mammalian thymus has developmental contribution from some pharyngeal pouch 3; Mammalian thymus has developmental contribution from some pharyngeal pouch 4 [Kardong]" ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "x has developmental contribution from y iff x has some part z such that z develops from y"@en ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:domain obo:UBERON_0001062 ; rdfs:label "has developmental contribution from"@en ; rdfs:range obo:UBERON_0001062 ; rdfs:subPropertyOf obo:RO_0002258 ; owl:inverseOf obo:RO_0002255 ; owl:propertyChainAxiom (obo:BFO_0000051 obo:RO_0002254 ) . obo:RO_0002255 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "inverse of has developmental contribution from" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "developmentally contributes to"@en ; rdfs:subPropertyOf obo:RO_0002286, obo:RO_0002385 ; owl:propertyChainAxiom (obo:RO_0002203 obo:BFO_0000050 ) . obo:RO_0002258 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "Candidate definition: x developmentally related to y if and only if there exists some developmental process (GO:0032502) p such that x and y both participates in p, and x is the output of p and y is the input of p" ; obo:IAO_0000116 false ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000002 ; rdfs:label "developmentally preceded by"@en ; rdfs:range obo:BFO_0000002 ; rdfs:subPropertyOf obo:RO_0002324 ; owl:inverseOf obo:RO_0002286 . obo:RO_0002263 obo:IAO_0000112 "A faulty traffic light (material entity) whose malfunctioning (a process) is causally upstream of a traffic collision (a process): the traffic light acts upstream of the collision." ; obo:IAO_0000115 "c acts upstream of p if and only if c enables some f that is involved in p' and p' occurs chronologically before p, is not part of p, and affects the execution of p. c is a material entity and f, p, p' are processes." ; a owl:ObjectProperty ; rdfs:label "acts upstream of" ; rdfs:subPropertyOf obo:RO_0002264 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002411 ) . obo:RO_0002264 obo:IAO_0000112 "A gene product that has some activity, where that activity may be a part of a pathway or upstream of the pathway." ; obo:IAO_0000115 "c acts upstream of or within p if c is enables f, and f is causally upstream of or within p. c is a material entity and p is an process." ; a owl:ObjectProperty ; rdfs:label "acts upstream of or within" ; rdfs:subPropertyOf obo:RO_0002500 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002418 ) . obo:RO_0002286 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "Inverse of developmentally preceded by" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "developmentally succeeded by"@en ; rdfs:subPropertyOf obo:RO_0002384 . obo:RO_0002295 obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000115 "p results in the developmental progression of s iff p is a developmental process and s is an anatomical entity and p causes s to undergo a change in state at some point along its natural developmental cycle (this cycle starts with its formation, through the mature structure, and ends with its loss)." ; obo:IAO_0000116 "This property and its subproperties are being used primarily for the definition of GO developmental processes. The property hierarchy mirrors the core GO hierarchy. In future we may be able to make do with a more minimal set of properties, but due to the way GO is currently structured we require highly specific relations to avoid incorrect entailments. To avoid this, the corresponding genus terms in GO should be declared mutually disjoint." ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:domain obo:GO_0008150 ; rdfs:label "results in developmental progression of"@en ; rdfs:range obo:UBERON_0001062 ; rdfs:subPropertyOf obo:RO_0002324 . obo:RO_0002297 obo:IAO_0000112 "an annotation of gene X to anatomical structure formation with results_in_formation_of UBERON:0000007 (pituitary gland) means that at the beginning of the process a pituitary gland does not exist and at the end of the process a pituitary gland exists.", "every \"endocardial cushion formation\" (GO:0003272) results_in_formation_of some \"endocardial cushion\" (UBERON:0002062)"@en ; obo:IAO_0000114 obo:IAO_0000125 ; obo:IAO_0000117 ; obo:IAO_0000119 "GOC:mtg_berkeley_2013" ; a owl:ObjectProperty ; rdfs:label "results in formation of anatomical entity"@en ; rdfs:subPropertyOf obo:RO_0002234, obo:RO_0002295 ; owl:inverseOf obo:RO_0002354 . obo:RO_0002304 obo:IAO_0000115 "p is causally upstream of, positive effect q iff p is casually upstream of q, and the execution of p is required for the execution of q." ; a owl:ObjectProperty ; rdfs:label "causally upstream of, positive effect" ; rdfs:subPropertyOf obo:RO_0002411, obo:RO_0004047 . obo:RO_0002305 obo:IAO_0000115 "p is causally upstream of, negative effect q iff p is casually upstream of q, and the execution of p decreases the execution of q." ; a owl:ObjectProperty ; rdfs:label "causally upstream of, negative effect" ; rdfs:subPropertyOf obo:RO_0002411, obo:RO_0004046 . obo:RO_0002314 obo:IAO_0000115 "q characteristic of part of w if and only if there exists some p such that q inheres in p and p part of w." ; obo:IAO_0000116 "Because part_of is transitive, inheres in is a sub-relation of characteristic of part of" ; obo:IAO_0000117 ; obo:IAO_0000118 "inheres in part of" ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "characteristic of part of"@en ; rdfs:subPropertyOf obo:RO_0002502 ; owl:propertyChainAxiom (obo:RO_0002314 obo:BFO_0000050 ) . obo:RO_0002320 obo:IAO_0000115 "A relationship that holds via some environmental process" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "evolutionarily related to"@en . obo:RO_0002323 obo:IAO_0000115 "A mereological relationship or a topological relationship" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "mereotopologically related to"@en . obo:RO_0002324 obo:IAO_0000115 "A relationship that holds between entities participating in some developmental process (GO:0032502)" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "developmentally related to"@en . obo:RO_0002327 obo:IAO_0000112 "a particular instances of akt-2 enables some instance of protein kinase activity" ; obo:IAO_0000115 "c enables p iff c is capable of p and c acts to execute p." ; obo:IAO_0000117 ; obo:IAO_0000118 "catalyzes", "executes", "has", "is catalyzing", "is executing" ; a owl:ObjectProperty ; rdfs:label "enables"@en ; rdfs:subPropertyOf obo:RO_0002215 ; owl:inverseOf obo:RO_0002333 ; owl:propertyChainAxiom (obo:RO_0002327 obo:BFO_0000051 ), (obo:RO_0002327 obo:RO_0002017 ) . obo:RO_0002328 obo:IAO_0000115 "A grouping relationship for any relationship directly involving a function, or that holds because of a function of one of the related entities." ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "functionally related to"@en . obo:RO_0002329 obo:IAO_0000115 "this relation holds between c and p when c is part of some c', and c' is capable of p." ; obo:IAO_0000117 ; obo:IAO_0000118 false ; a owl:ObjectProperty ; rdfs:label "part of structure that is capable of"@en ; rdfs:subPropertyOf obo:RO_0002328 . obo:RO_0002331 obo:IAO_0000115 "c involved_in p if and only if c enables some process p', and p' is part of p" ; obo:IAO_0000117 ; obo:IAO_0000118 "actively involved in", "enables part of" ; a owl:ObjectProperty ; rdfs:label "involved in"@en ; rdfs:subPropertyOf obo:RO_0000056, obo:RO_0002431 ; owl:propertyChainAxiom (obo:RO_0002327 obo:BFO_0000050 ), (obo:RO_0002331 obo:BFO_0000050 ) . obo:RO_0002333 obo:IAO_0000115 "inverse of enables" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "enabled by"@en ; rdfs:subPropertyOf obo:RO_0000057, obo:RO_0002328 . obo:RO_0002334 obo:IAO_0000115 "inverse of regulates" ; obo:IAO_0000117 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:domain obo:BFO_0000015 ; rdfs:label "regulated by"@en ; rdfs:range obo:BFO_0000015 ; rdfs:subPropertyOf obo:RO_0002427 . obo:RO_0002335 obo:IAO_0000115 "inverse of negatively regulates" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "negatively regulated by"@en ; rdfs:subPropertyOf obo:RO_0002334 . obo:RO_0002336 obo:IAO_0000115 "inverse of positively regulates" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "positively regulated by"@en ; rdfs:subPropertyOf obo:RO_0002334 . obo:RO_0002350 obo:IAO_0000112 "An organism that is a member of a population of organisms" ; obo:IAO_0000115 "is member of is a mereological relation between a item and a collection." ; obo:IAO_0000118 "is member of", "member part of" ; obo:IAO_0000119 "SIO" ; obo:RO_0001900 obo:RO_0001901 ; a owl:ObjectProperty ; rdfs:label "is member of", "member of"@en ; rdfs:subPropertyOf obo:BFO_0000050 ; owl:inverseOf obo:RO_0002351 . obo:RO_0002351 obo:IAO_0000112 """Example 1: a collection of sequences such as a genome being comprised of separate sequences of chromosomes Example 2: a collection of information entities such as a genotype being comprised of a background component and a variant component""" ; obo:IAO_0000115 "has member is a mereological relation between a collection and an item." ; obo:IAO_0000119 "SIO" ; obo:RO_0001900 obo:RO_0001901 ; a owl:IrreflexiveProperty, owl:ObjectProperty ; rdfs:label "has member", "has member"@en ; rdfs:subPropertyOf obo:BFO_0000051 . obo:RO_0002352 obo:IAO_0000115 "inverse of has input" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "input of"@en ; rdfs:subPropertyOf obo:RO_0000056, obo:RO_0002328 . obo:RO_0002353 obo:IAO_0000115 "inverse of has output" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "output of"@en ; rdfs:subPropertyOf obo:RO_0000056, obo:RO_0002328 . obo:RO_0002354 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "formed as result of"@en, "obsolete_formed as result of"@en ; rdfs:subPropertyOf obo:RO_0002353, oboInOwl:ObsoleteProperty . obo:RO_0002384 obo:IAO_0000114 obo:IAO_0000428 ; obo:IAO_0000115 "x has developmental potential involving y iff x is capable of a developmental process with output y. y may be the successor of x, or may be a different structure in the vicinity (as for example in the case of developmental induction)."@en ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:domain obo:UBERON_0001062 ; rdfs:label "has developmental potential involving"@en ; rdfs:range obo:UBERON_0001062 ; rdfs:subPropertyOf obo:RO_0002324 . obo:RO_0002385 obo:IAO_0000114 obo:IAO_0000428 ; obo:IAO_0000115 "x has potential to developmentrally contribute to y iff x developmentally contributes to y or x is capable of developmentally contributing to y"@en ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "has potential to developmentally contribute to"@en ; rdfs:subPropertyOf obo:RO_0002384 . obo:RO_0002387 obo:IAO_0000114 obo:IAO_0000428 ; obo:IAO_0000115 "x has the potential to develop into y iff x develops into y or if x is capable of developing into y"@en ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "has potential to develop into"@en ; rdfs:subPropertyOf obo:RO_0002384 . obo:RO_0002388 obo:IAO_0000114 obo:IAO_0000428 ; obo:IAO_0000115 "x has potential to directly develop into y iff x directly develops into y or x is capable of directly developing into y"@en ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "has potential to directly develop into"@en ; rdfs:subPropertyOf obo:RO_0002387 . obo:RO_0002404 obo:IAO_0000114 obo:IAO_0000428 ; obo:IAO_0000115 "inverse of upstream of" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "causally downstream of"@en ; rdfs:subPropertyOf obo:BFO_0000062, obo:RO_0002427 ; owl:inverseOf obo:RO_0002411 . obo:RO_0002405 obo:IAO_0000114 obo:IAO_0000428 ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "immediately causally downstream of"@en ; rdfs:subPropertyOf obo:RO_0002087, obo:RO_0002404 ; owl:inverseOf obo:RO_0002412 . obo:RO_0002407 obo:IAO_0000115 "p indirectly positively regulates q iff p is indirectly causally upstream of q and p positively regulates q." ; obo:IAO_0000117 ; obo:IAO_0000118 "indirectly activates" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "indirectly positively regulates"@en ; rdfs:subPropertyOf obo:RO_0002213, obo:RO_0012012 ; owl:propertyChainAxiom (obo:RO_0002407 obo:RO_0002629 ), (obo:RO_0002409 obo:RO_0002409 ), (obo:RO_0002629 obo:RO_0002407 ), (obo:RO_0002629 obo:RO_0002629 ) . obo:RO_0002409 obo:IAO_0000115 "p indirectly negatively regulates q iff p is indirectly causally upstream of q and p negatively regulates q." ; obo:IAO_0000117 ; obo:IAO_0000118 "indirectly inhibits" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "indirectly negatively regulates"@en ; rdfs:subPropertyOf obo:RO_0002212, obo:RO_0012012 ; owl:propertyChainAxiom (obo:RO_0002409 obo:RO_0002630 ), (obo:RO_0002630 obo:RO_0002409 ), (obo:RO_0002630 obo:RO_0002630 ) . obo:RO_0002410 obo:IAO_0000115 "relation that links two events, processes, states, or objects such that one event, process, state, or object (a cause) contributes to the production of another event, process, state, or object (an effect) where the cause is partly or wholly responsible for the effect, and the effect is partly or wholly dependent on the cause." ; obo:IAO_0000116 """This branch of the ontology deals with causal relations between entities. It is divided into two branches: causal relations between occurrents/processes, and causal relations between material entities. We take an 'activity flow-centric approach', with the former as primary, and define causal relations between material entities in terms of causal relations between occurrents. To define causal relations in an activity-flow type network, we make use of 3 primitives: * Temporal: how do the intervals of the two occurrents relate? * Is the causal relation regulatory? * Is the influence positive or negative? The first of these can be formalized in terms of the Allen Interval Algebra. Informally, the 3 bins we care about are 'direct', 'indirect' or overlapping. Note that all causal relations should be classified under a RO temporal relation (see the branch under 'temporally related to'). Note that all causal relations are temporal, but not all temporal relations are causal. Two occurrents can be related in time without being causally connected. We take causal influence to be primitive, elucidated as being such that has the upstream changed, some qualities of the donwstream would necessarily be modified. For the second, we consider a relationship to be regulatory if the system in which the activities occur is capable of altering the relationship to achieve some objective. This could include changing the rate of production of a molecule. For the third, we consider the effect of the upstream process on the output(s) of the downstream process. If the level of output is increased, or the rate of production of the output is increased, then the direction is increased. Direction can be positive, negative or neutral or capable of either direction. Two positives in succession yield a positive, two negatives in succession yield a positive, otherwise the default assumption is that the net effect is canceled and the influence is neutral. Each of these 3 primitives can be composed to yield a cross-product of different relation types.""" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "causally related to"@en . obo:RO_0002411 obo:IAO_0000115 "p is causally upstream of q iff p is causally related to q, the end of p precedes the end of q, and p is not an occurrent part of q." ; obo:IAO_0000117 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "causally upstream of"@en ; rdfs:subPropertyOf obo:BFO_0000063, obo:RO_0002418 . obo:RO_0002412 obo:IAO_0000115 "p is immediately causally upstream of q iff p is causally upstream of q, and the end of p is coincident with the beginning of q." ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "immediately causally upstream of"@en ; rdfs:subPropertyOf obo:RO_0002090, obo:RO_0002411 . obo:RO_0002413 obo:IAO_0000115 "p provides input for q iff p is immediately causally upstream of q, and there exists some c such that p has_output c and q has_input c." ; obo:IAO_0000117 ; obo:IAO_0000118 "directly provides input for" ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "provides input for"@en ; rdfs:subPropertyOf obo:RO_0002412, obo:RO_0002414 ; owl:propertyChainAxiom (obo:RO_0002234 obo:RO_0002233 ) . obo:RO_0002414 obo:IAO_0000114 obo:IAO_0000428 ; obo:IAO_0000115 "transitive form of directly_provides_input_for" ; obo:IAO_0000117 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:domain obo:BFO_0000015 ; rdfs:label "transitively provides input for"@en ; rdfs:range obo:BFO_0000015 ; rdfs:subPropertyOf obo:RO_0004047 . obo:RO_0002418 obo:IAO_0000115 "p is 'causally upstream or within' q iff p is causally related to q, and the end of p precedes, or is coincident with, the end of q." ; obo:IAO_0000116 "We would like to make this disjoint with 'preceded by', but this is prohibited in OWL2" ; obo:IAO_0000117 ; obo:IAO_0000118 "influences (processual)" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "causally upstream of or within" ; rdfs:subPropertyOf obo:RO_0002501 ; owl:inverseOf obo:RO_0002427 ; owl:propertyChainAxiom (obo:RO_0002418 obo:BFO_0000050 ) . obo:RO_0002427 obo:IAO_0000115 "inverse of causally upstream of or within" ; obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "causally downstream of or within" ; rdfs:subPropertyOf obo:RO_0002501 . obo:RO_0002428 obo:IAO_0000115 "c involved in regulation of p if c is involved in some p' and p' regulates some p" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "involved in regulation of" ; rdfs:subPropertyOf obo:RO_0002263, obo:RO_0002431 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002211 ), (obo:RO_0002331 obo:RO_0002211 ) . obo:RO_0002429 obo:IAO_0000115 "c involved in regulation of p if c is involved in some p' and p' positively regulates some p" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "involved in positive regulation of" ; rdfs:subPropertyOf obo:RO_0002428 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002213 ), (obo:RO_0002331 obo:RO_0002213 ) . obo:RO_0002430 obo:IAO_0000115 "c involved in regulation of p if c is involved in some p' and p' negatively regulates some p" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "involved in negative regulation of" ; rdfs:subPropertyOf obo:RO_0002428 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002212 ), (obo:RO_0002331 obo:RO_0002212 ) . obo:RO_0002431 obo:IAO_0000115 "c involved in or regulates p if and only if either (i) c is involved in p or (ii) c is involved in regulation of p" ; obo:IAO_0000116 "OWL does not allow defining object properties via a Union" ; obo:IAO_0000117 ; obo:IAO_0000118 "involved in or reguates" ; a owl:ObjectProperty ; rdfs:label "involved in or involved in regulation of" ; rdfs:subPropertyOf obo:RO_0002264, obo:RO_0002328, obo:RO_0002500 . obo:RO_0002434 obo:IAO_0000115 "A relationship that holds between two entities in which the processes executed by the two entities are causally connected." ; obo:IAO_0000116 "Considering relabeling as 'pairwise interacts with'"^^xsd:anyURI, "This relation and all sub-relations can be applied to either (1) pairs of entities that are interacting at any moment of time (2) populations or species of entity whose members have the disposition to interact (3) classes whose members have the disposition to interact." ; obo:IAO_0000117 ; a owl:ObjectProperty, owl:SymmetricProperty ; rdfs:domain obo:BFO_0000040 ; rdfs:label "interacts with" ; rdfs:range obo:BFO_0000040 . obo:RO_0002436 obo:IAO_0000115 "An interaction relationship in which the two partners are molecular entities that directly physically interact with each other for example via a stable binding interaction or a brief interaction during which one modifies the other." ; obo:IAO_0000117 ; obo:IAO_0000118 "binds", "molecularly binds with" ; a owl:ObjectProperty, owl:SymmetricProperty ; rdfs:label "molecularly interacts with" ; rdfs:subPropertyOf obo:RO_0002434 . obo:RO_000244 obo:IAO_0000115 "Holds between molecular entities a and b when the execution of a activates or inhibits the activity of b" ; a owl:ObjectProperty ; rdfs:label "molecularly controls"@en . obo:RO_0002447 obo:IAO_0000116 "Axiomatization to GO to be added later" ; obo:IAO_0000117 ; obo:IAO_0000118 "An interaction relation between x and y in which x catalyzes a reaction in which a phosphate group is added to y." ; a owl:ObjectProperty ; rdfs:label "phosphorylates" ; rdfs:subPropertyOf obo:RO_0002436 . obo:RO_0002448 obo:IAO_0000115 """The entity A, immediately upstream of the entity B, has an activity that regulates an activity performed by B. For example, A and B may be gene products and binding of B by A regulates the kinase activity of B. A and B can be physically interacting but not necessarily. Immediately upstream means there are no intermediate entity between A and B.""" ; obo:IAO_0000117 , ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000040 ; rdfs:label "directly regulates activity of" ; rdfs:range obo:BFO_0000040 ; rdfs:subPropertyOf obo:RO_0002436, obo:RO_0011002 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002211 obo:RO_0002333 ) . obo:RO_0002449 obo:IAO_0000115 """The entity A, immediately upstream of the entity B, has an activity that negatively regulates an activity performed by B. For example, A and B may be gene products and binding of B by A negatively regulates the kinase activity of B.""" ; obo:IAO_0000117 , ; obo:IAO_0000118 "directly inhibits" ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000040 ; rdfs:label "directly negatively regulates activity of" ; rdfs:range obo:BFO_0000040 ; rdfs:subPropertyOf obo:RO_0002448 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002630 obo:RO_0002333 ) . obo:RO_0002450 obo:IAO_0000115 """The entity A, immediately upstream of the entity B, has an activity that positively regulates an activity performed by B. For example, A and B may be gene products and binding of B by A positively regulates the kinase activity of B.""" ; obo:IAO_0000117 , ; obo:IAO_0000118 "directly activates" ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000040 ; rdfs:label "directly positively regulates activity of" ; rdfs:range obo:BFO_0000040 ; rdfs:subPropertyOf obo:RO_0002448 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002629 obo:RO_0002333 ) . obo:RO_0002464 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "helper property (not for use in curation)" . obo:RO_0002481 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "is kinase activity" ; rdfs:subPropertyOf obo:RO_0002564 . obo:RO_0002500 obo:IAO_0000115 "A relationship between a material entity and a process where the material entity has some causal role that influences the process" ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "causal agent in process" ; rdfs:subPropertyOf obo:RO_0002595 ; owl:inverseOf obo:RO_0002608 . obo:RO_0002501 obo:IAO_0000115 "p is causally related to q if and only if p or any part of p and q or any part of q are linked by a chain of events where each event pair is one where the execution of p influences the execution of q. p may be upstream, downstream, part of, or a container of q." ; obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000003 ; rdfs:label "causal relation between processes" ; rdfs:range obo:BFO_0000003 ; rdfs:subPropertyOf obo:RO_0002410 . obo:RO_0002502 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "depends on" . obo:RO_0002506 obo:IAO_0000116 "The intent is that the process branch of the causal property hierarchy is primary (causal relations hold between occurrents/processes), and that the material branch is defined in terms of the process branch" ; obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000002 ; rdfs:label "causal relation between entities" ; rdfs:range obo:BFO_0000002 ; rdfs:subPropertyOf obo:RO_0002410 . obo:RO_0002514 obo:IAO_0000115 "A relation that holds between two entities that have the property of being sequences or having sequences. " ; obo:IAO_0000117 ; obo:IAO_0000119 "http://www.ncbi.nlm.nih.gov/pubmed/20226267"^^xsd:anyURI ; a owl:ObjectProperty ; rdfs:domain obo:RO_0002532 ; rdfs:label "sequentially related to" ; rdfs:range obo:RO_0002532 . obo:RO_0002522 obo:IAO_0000112 "The genomic exons of a transcript bound the sequence of the genomic introns of the same transcript (but the introns are not subsequences of the exons)" ; obo:IAO_0000115 "x bounds the sequence of y iff the upstream-most part of x is upstream of or coincident with the upstream-most part of y, and the downstream-most part of x is downstream of or coincident with the downstream-most part of y" ; obo:IAO_0000117 , "Chris Mungall" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "bounds sequence of" ; rdfs:subPropertyOf obo:GENO_0000654, obo:RO_0002514 ; owl:inverseOf obo:RO_0002523 . obo:RO_0002523 obo:IAO_0000115 "inverse of bounds sequence of" ; obo:IAO_0000117 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "is bound by sequence of" ; rdfs:subPropertyOf obo:RO_0002514 . obo:RO_0002524 obo:IAO_0000115 "x has subsequence y iff all of the sequence parts of x are sequence parts of y", "x has subsequence y iff all of the sequence parts of y are sequence parts of x" ; obo:IAO_0000117 ; obo:IAO_0000118 "contains" ; obo:IAO_0000119 "http://www.ncbi.nlm.nih.gov/pubmed/20226267"^^xsd:anyURI ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "has subsequence", "has subsequence"@en ; rdfs:subPropertyOf obo:BFO_0000051, obo:GENO_0000654, obo:RO_0002522, obo:RO_0002526 ; owl:inverseOf obo:RO_0002525 . obo:RO_0002525 obo:IAO_0000115 "inverse of has subsequence" ; obo:IAO_0000117 ; obo:IAO_0000118 "contained by" ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "is subsequence of", "is subsequence of"@en ; rdfs:subPropertyOf obo:BFO_0000050, obo:GENO_0000655, obo:RO_0002523, obo:RO_0002526 . obo:RO_0002526 obo:IAO_0000115 "x overlaps the sequence of x if and only if x has a subsequence z and z is a subsequence of y.", "x overlaps the sequence of y if and only if x has a subsequence z and z is a subsequence of y." ; obo:IAO_0000117 ; dcterms:source "http://biorxiv.org/content/early/2014/06/27/006650.abstract" ; a owl:ObjectProperty, owl:SymmetricProperty ; rdfs:label "overlaps sequence of" ; rdfs:subPropertyOf obo:RO_0002131, obo:RO_0002514 ; owl:propertyChainAxiom (obo:RO_0002524 obo:RO_0002525 ) . obo:RO_0002527 obo:IAO_0000115 "x does not overlap the sequence of y if and only if there is no z such that x has a subsequence z and z is a subsequence of y." ; obo:IAO_0000117 ; obo:IAO_0000118 "disconnected from" ; a owl:ObjectProperty, owl:SymmetricProperty ; rdfs:label "does not overlap sequence of" ; rdfs:subPropertyOf obo:RO_0002514 . obo:RO_0002528 obo:IAO_0000115 "inverse of downstream of sequence of" ; obo:IAO_0000117 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "is upstream of sequence of", "is upstream of sequence of"@en ; rdfs:subPropertyOf obo:RO_0002527 . obo:RO_0002529 obo:IAO_0000115 "x is downstream of the sequence of y iff either (1) x and y have sequence units, and all units of x are downstream of all units of y, or (2) x and y are sequence units, and x is either immediately downstream of y, or transitively downstream of y." ; obo:IAO_0000117 ; a owl:ObjectProperty, owl:TransitiveProperty ; rdfs:label "is downstream of sequence of", "is downstream of sequence of"@en ; rdfs:subPropertyOf obo:RO_0002527 ; owl:inverseOf obo:RO_0002529 . obo:RO_0002532 obo:IAO_0000115 "Any entity that is ordered in discrete units along a linear axis." ; obo:IAO_0000117 ; a owl:Class ; rdfs:label "sequentially ordered entity" ; rdfs:subClassOf [ a owl:Restriction ; owl:onProperty obo:RO_0002524 ; owl:someValuesFrom obo:RO_0002533 ] . obo:RO_0002533 obo:IAO_0000115 "Any individual unit of a collection of like units arranged in a linear order" ; obo:IAO_0000117 ; a owl:Class ; rdfs:label "sequence atomic unit" ; rdfs:subClassOf obo:RO_0002532 . obo:RO_0002559 obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "causally influenced by" ; rdfs:subPropertyOf obo:RO_0002506 ; owl:inverseOf obo:RO_0002566 . obo:RO_0002563 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "interaction relation helper property" ; rdfs:subPropertyOf obo:RO_0002464 . obo:RO_0002564 obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "molecular interaction relation helper property" ; rdfs:subPropertyOf obo:RO_0002563 . obo:RO_0002566 obo:IAO_0000115 "The entity or characteristic A is causally upstream of the entity or characteristic B, A having an effect on B. An entity corresponds to any biological type of entity as long as a mass is measurable. A characteristic corresponds to a particular specificity of an entity (e.g., phenotype, shape, size)." ; obo:IAO_0000117 , ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000002 ; rdfs:label "causally influences" ; rdfs:range obo:BFO_0000002 ; rdfs:subPropertyOf obo:RO_0002506 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002411 obo:RO_0002233 ), (obo:RO_0002327 obo:RO_0002411 obo:RO_0002333 ) . obo:RO_0002577 obo:IAO_0000115 "A material entity consisting of multiple components that are causally integrated." ; obo:IAO_0000116 "May be replaced by a BFO class, as discussed in http://www.jbiomedsem.com/content/4/1/43" ; obo:IAO_0000117 ; obo:IAO_0000119 "http://www.jbiomedsem.com/content/4/1/43" ; a owl:Class ; rdfs:label "system" ; rdfs:subClassOf obo:BFO_0000040 . obo:RO_0002578 obo:IAO_0000115 "p directly regulates q iff p is immediately causally upstream of q and p regulates q." ; obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "directly regulates" ; rdfs:subPropertyOf obo:RO_0002211, obo:RO_0002412 . obo:RO_0002584 obo:IAO_0000112 "gland SubClassOf 'has part structure that is capable of' some 'secretion by cell'" ; obo:IAO_0000115 "s 'has part structure that is capable of' p if and only if there exists some part x such that s 'has part' x and x 'capable of' p" ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:label "has part structure that is capable of" ; rdfs:subPropertyOf obo:RO_0002328, obo:RO_0002595 ; owl:propertyChainAxiom (obo:BFO_0000051 obo:RO_0002215 ) . obo:RO_0002595 obo:IAO_0000115 "A relationship that holds between a material entity and a process in which causality is involved, with either the material entity or some part of the material entity exerting some influence over the process, or the process influencing some aspect of the material entity." ; obo:IAO_0000116 "Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect." ; obo:IAO_0000117 ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000040 ; rdfs:label "causal relation between material entity and a process" ; rdfs:range obo:BFO_0000015 ; rdfs:subPropertyOf obo:RO_0002410 . obo:RO_0002596 obo:IAO_0000112 "pyrethroid -> growth" ; obo:IAO_0000115 "Holds between c and p if and only if c is capable of some activity a, and a regulates p." ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "capable of regulating" ; rdfs:subPropertyOf obo:RO_0002500 ; owl:propertyChainAxiom (obo:RO_0002215 obo:RO_0002211 ) . obo:RO_0002597 obo:IAO_0000115 "Holds between c and p if and only if c is capable of some activity a, and a negatively regulates p." ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "capable of negatively regulating" ; rdfs:subPropertyOf obo:RO_0002596 ; owl:propertyChainAxiom (obo:RO_0002215 obo:RO_0002212 ) . obo:RO_0002598 obo:IAO_0000112 "renin -> arteriolar smooth muscle contraction" ; obo:IAO_0000115 "Holds between c and p if and only if c is capable of some activity a, and a positively regulates p." ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "capable of positively regulating" ; rdfs:subPropertyOf obo:RO_0002596 ; owl:propertyChainAxiom (obo:RO_0002215 obo:RO_0002213 ) . obo:RO_0002608 obo:IAO_0000115 "Inverse of 'causal agent in process'" ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "process has causal agent" ; rdfs:subPropertyOf obo:RO_0002410 . obo:RO_0002610 obo:IAO_0000115 "A relationship that holds between two entities, where the entities exhibit a statistical dependence relationship. The entities may be statistical variables, or they may be other kinds of entities such as diseases, chemical entities or processes." ; a owl:ObjectProperty ; rdfs:label "correlated with" . obo:RO_0002615 obo:IAO_0000115 "Inverse of is-model-of" ; a owl:ObjectProperty ; rdfs:label "has model" ; owl:inverseOf obo:RO_0003301 . obo:RO_0002629 obo:IAO_0000115 "p directly positively regulates q iff p is immediately causally upstream of q, and p positively regulates q." ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "directly positively regulates" ; rdfs:subPropertyOf obo:RO_0002213, obo:RO_0002578 . obo:RO_0002630 obo:IAO_0000115 "p directly negatively regulates q iff p is immediately causally upstream of q, and p negatively regulates q." ; obo:IAO_0000119 ; a owl:ObjectProperty ; rdfs:label "directly negatively regulates" ; rdfs:subPropertyOf obo:RO_0002212, obo:RO_0002578 . obo:RO_0003301 obo:IAO_0000115 "A relation between a biological, experimental, or computational artifact and an entity it is used to study, in virtue of its replicating or approximating features of the studied entity.", "Relation between a research artifact and an entity it is used to study, in virtue of its replicating or approximating features of the studied entity." ; obo:IAO_0000116 "To Do: decide on scope of this relation - inclusive of computational models in domain, or only physical models? Restricted to linking biological systems and phenomena? Inclusive of only diseases in range, or broader?" ; obo:IAO_0000117 , "Matthew Brush" ; obo:IAO_0000118 "is used to study"@en ; a owl:AsymmetricProperty, owl:IrreflexiveProperty, owl:ObjectProperty ; rdfs:comment "The driving use case for this relation was to link a biological model system such as a cell line or model organism to a disease it is used to investigate, in virtue of the model system exhibiting features similar to that of the disease of interest." ; rdfs:label "has role in modeling"@en, "is model of"@en . obo:RO_0003302 obo:IAO_0000112 """The genetic variant 'NM_007294.3(BRCA1):c.110C>A (p.Thr37Lys)' casues or contributes to the disease 'familial breast-ovarian cancer'. An environment of exposure to arsenic causes or contributes to the phenotype of patchy skin hyperpigmentation, and the disease 'skin cancer'.""" ; obo:IAO_0000115 "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some causal or contributing role that influences the condition.", "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity has some causal or contributing role that influences the condition." ; obo:IAO_0000116 "Note that relationships of phenotypes to organisms/strains that bear them, or diseases they are manifest in, should continue to use RO:0002200 ! 'has phenotype' and RO:0002201 ! 'phenotype of'." ; a owl:ObjectProperty ; rdfs:comment """Genetic variations can span any level of granularity from a full genome or genotype to an individual gene or sequence alteration. These variations can be represented at the physical level (DNA/RNA macromolecules or their parts, as in the ChEBI ontology and Molecular Sequence Ontology) or at the abstract level (generically dependent continuant sequence features that are carried by these macromolecules, as in the Sequence Ontology and Genotype Ontology). The causal relations in this hierarchy can be used in linking either physical or abstract genetic variations to phenotypes or diseases they cause or contribute to. Environments include natural environments or exposures, experimentally applied conditions, or clinical interventions.""" ; rdfs:label "causes or contributes to condition"@en ; rdfs:subPropertyOf obo:GENO_0000790, obo:RO_0002410 . obo:RO_0003303 obo:IAO_0000115 "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has a causal role for the condition.", "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity has some causal role for the condition." ; a owl:ObjectProperty ; rdfs:label "causes condition"@en ; rdfs:subPropertyOf obo:RO_0003302 . obo:RO_0003304 obo:IAO_0000115 "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some contributing role in the manifestation of the condition.", "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity has some contributing role that influences the condition." ; a owl:ObjectProperty ; rdfs:label "contributes to condition"@en ; rdfs:subPropertyOf obo:RO_0003302 . obo:RO_0003305 obo:IAO_0000115 "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the severity with which a condition manifests in an individual.", "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity influences the severity with which a condition manifests in an individual." ; obo:IAO_0000118 "contributes to expressivity of condition" ; a owl:ObjectProperty ; rdfs:label "contributes to severity of condition"@en ; rdfs:subPropertyOf obo:RO_0003304 . obo:RO_0003306 obo:IAO_0000115 "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the frequency of the condition in a population.", "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity influences the frequency of the condition in a population." ; obo:IAO_0000118 "contributes to penetrance of condition" ; a owl:ObjectProperty ; rdfs:label "contributes to frequency of condition"@en ; rdfs:subPropertyOf obo:RO_0003304 . obo:RO_0003307 obo:IAO_0000115 "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity prevents or reduces the severity of a condition.", "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the presence of the entity reduces or eliminates some or all aspects of the condition." ; obo:IAO_0000118 "is preventative for condition" ; a owl:ObjectProperty ; rdfs:comment """Genetic variations can span any level of granularity from a full genome or genotype to an individual gene or sequence alteration. These variations can be represented at the physical level (DNA/RNA macromolecules or their parts, as in the ChEBI ontology and Molecular Sequence Ontology) or at the abstract level (generically dependent continuant sequence features that are carried by these macromolecules, as in the Sequence Ontology and Genotype Ontology). The causal relations in this hierarchy can be used in linking either physical or abstract genetic variations to phenotypes or diseases they cause or contribute to. Environments include natural environments or exposures, experimentally applied conditions, or clinical interventions.""" ; rdfs:label "ameliorates condition"@en, "is preventative for condition"@en ; rdfs:subPropertyOf obo:GENO_0000790, obo:RO_0003305 . obo:RO_0003308 obo:IAO_0000115 "A relationship between an entity and a condition (phenotype or disease) with which it exhibits a statistical dependence relationship." ; a owl:ObjectProperty ; rdfs:label "correlated with condition"@en ; rdfs:subPropertyOf obo:GENO_0000790, obo:RO_0002610 . obo:RO_0004031 obo:IAO_0000115 "Holds between an entity and an process P where the entity enables some larger compound process, and that larger process has-part P." ; a owl:ObjectProperty ; rdfs:label "enables subfunction" ; rdfs:subPropertyOf obo:RO_0002328 ; owl:propertyChainAxiom (obo:RO_0002327 obo:BFO_0000051 ) . obo:RO_0004032 a owl:ObjectProperty ; rdfs:label "acts upstream of or within, positive effect" ; rdfs:subPropertyOf obo:RO_0002264 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0004047 ) . obo:RO_0004033 a owl:ObjectProperty ; rdfs:label "acts upstream of or within, negative effect" ; rdfs:subPropertyOf obo:RO_0002264 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0004046 ) . obo:RO_0004034 obo:IAO_0000115 "c 'acts upstream of, positive effect' p if c is enables f, and f is causally upstream of p, and the direction of f is positive" ; a owl:ObjectProperty ; rdfs:label "acts upstream of, positive effect" ; rdfs:subPropertyOf obo:RO_0002263, obo:RO_0004032 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002304 ) . obo:RO_0004035 obo:IAO_0000115 "c 'acts upstream of, negative effect' p if c is enables f, and f is causally upstream of p, and the direction of f is negative" ; a owl:ObjectProperty ; rdfs:label "acts upstream of, negative effect" ; rdfs:subPropertyOf obo:RO_0002263, obo:RO_0004033 ; owl:propertyChainAxiom (obo:RO_0002327 obo:RO_0002305 ) . obo:RO_0004046 a owl:ObjectProperty ; rdfs:label "causally upstream of or within, negative effect" ; rdfs:subPropertyOf obo:RO_0002418 . obo:RO_0004047 a owl:ObjectProperty ; rdfs:label "causally upstream of or within, positive effect" ; rdfs:subPropertyOf obo:RO_0002418 . obo:RO_0010001 obo:IAO_0000112 "Genetic information generically depend on molecules of DNA.", "The novel *War and Peace* generically depends on this copy of the novel.", "The pattern shared by chess boards generically depends on any chess board.", "The score of a symphony g-depends on a copy of the score.", "This pdf file generically depends on this server." ; obo:IAO_0000115 "A generically dependent continuant *b* generically depends on an independent continuant *c* at time *t* means: there inheres in *c* a specifically deendent continuant which concretizes *b* at *t*." ; obo:IAO_0000119 "[072-ISO]" ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000031 ; rdfs:label "generically depends on" ; rdfs:range obo:BFO_0000004 ; owl:inverseOf obo:RO_0010002 ; owl:propertyChainAxiom (obo:RO_0000052 obo:RO_0000058 ) . obo:RO_0010002 obo:IAO_0000112 "Molecules of DNA are carriers of genetic information.", "This copy of *War and Peace* is carrier of the novel written by Tolstoy.", "This hard drive is carrier of these data items." ; obo:IAO_0000115 "*b* is carrier of *c* at time *t* if and only if *c* *g-depends on* *b* at *t*" ; obo:IAO_0000119 "[072-ISO]" ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000004 ; rdfs:label "is carrier of"@en ; rdfs:range obo:BFO_0000031 ; owl:propertyChainAxiom (obo:RO_0000059 obo:RO_0000053 ) . obo:RO_0011002 obo:IAO_0000115 "The entity A has an activity that regulates an activity of the entity B. For example, A and B are gene products where the catalytic activity of A regulates the kinase activity of B." ; obo:IAO_0000117 ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000040 ; rdfs:label "regulates activity of" ; rdfs:range obo:BFO_0000040 ; rdfs:subPropertyOf obo:RO_0002566 . obo:RO_0012011 obo:IAO_0000115 "p is indirectly causally upstream of q iff p is causally upstream of q and there exists some process r such that p is causally upstream of r and r is causally upstream of q." ; a owl:ObjectProperty ; rdfs:label "indirectly causally upstream of"@en ; rdfs:subPropertyOf obo:RO_0002411 . obo:RO_0012012 obo:IAO_0000115 "p indirectly regulates q iff p is indirectly causally upstream of q and p regulates q." ; a owl:ObjectProperty ; rdfs:label "indirectly regulates"@en ; rdfs:subPropertyOf obo:RO_0002211, obo:RO_0012011 . obo:RO_0016001 a owl:ObjectProperty ; rdfs:label "has phenotype or disease" . obo:RO_0017001 obo:IAO_0000112 "A diagnostic testing device utilizes a specimen." ; obo:IAO_0000115 "X device utilizes material Y means X and Y are material entities, and X is capable of some process P that has input Y." ; a owl:ObjectProperty ; rdfs:label "device utilizes material"@en ; owl:propertyChainAxiom (obo:RO_0002215 obo:RO_0002233 ) . obo:RO_0019000 obo:IAO_0000115 "A relationship that holds between a process and a characteristic in which process (P) regulates characteristic (C) iff: P results in the existence of C OR affects the intensity or magnitude of C." ; a owl:ObjectProperty ; rdfs:domain obo:BFO_0000015 ; rdfs:label "regulates characteristic" ; rdfs:range obo:PATO_0000001 ; rdfs:subPropertyOf obo:RO_0002410 ; owl:propertyChainAxiom (obo:RO_0002211 obo:RO_0019000 ) . obo:RO_0019001 obo:IAO_0000115 "A relationship that holds between a process and a characteristic in which process (P) positively regulates characteristic (C) iff: P results in an increase in the intensity or magnitude of C." ; a owl:ObjectProperty ; rdfs:label "positively regulates characteristic" ; rdfs:subPropertyOf obo:RO_0019000 ; owl:propertyChainAxiom (obo:RO_0002213 obo:RO_0019001 ) . obo:RO_0019002 obo:IAO_0000115 "A relationship that holds between a process and a characteristic in which process (P) negatively regulates characteristic (C) iff: P results in a decrease in the intensity or magnitude of C." ; a owl:ObjectProperty ; rdfs:label "negatively regulates characteristic" ; rdfs:subPropertyOf obo:RO_0019000 ; owl:propertyChainAxiom (obo:RO_0002212 obo:RO_0019001 ), (obo:RO_0002213 obo:RO_0019002 ) . obo:RO_0020105 obo:IAO_0000115 "This property only applies to anatomical entities." ; a owl:ObjectProperty ; rdfs:domain obo:UBERON_0001062 ; rdfs:label "is anatomical entity" . obo:SO_0000001 obo:IAO_0000111 "region" ; obo:IAO_0000115 "A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids." ; obo:IAO_0000118 "primary structure of sequence macromolecule", "sequence" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "region" ; rdfs:subClassOf obo:BFO_0000031 . obo:SO_0000034 obo:IAO_0000115 "Morpholino oligos are synthesized from four different Morpholino subunits, each of which contains one of the four genetic bases (A, C, G, T) linked to a 6-membered morpholine ring. Eighteen to 25 subunits of these four subunit types are joined in a specific order by non-ionic phosphorodiamidate intersubunit linkages to give a Morpholino." ; a owl:Class ; rdfs:label "morpholino_oligo" ; rdfs:subClassOf obo:GENO_0000533 . obo:SO_0000105 obo:IAO_0000112 "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." ; obo:IAO_0000115 "A region of the chromosome between the centromere and the telomere. Human chromosomes have two arms, the p arm (short) and the q arm (long) which are separated from each other by the centromere." ; obo:IAO_0000116 "Formerly http://purl.obolibrary.org/obo/GENO_0000613, replaced by SO term." ; obo:IAO_0000119 """http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome > arm > region > band > sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome > arm > band > sub-band > sub-sub-band""" ; a owl:Class ; rdfs:label "chromosome arm"@en ; rdfs:subClassOf obo:SO_0000830, [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:SO_0000830 ] . obo:SO_0000110 obo:IAO_0000115 "Any extent of continuous biological sequence." ; obo:IAO_0000116 """GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern).""" ; a owl:Class ; rdfs:comment "A sequence feature is an extent of 'located' biological sequence, whose identity is determined by both its inherent sequence (ordering of monomeric units) and its position (start and end coordinates based on alignment with some reference). By contrast, 'biological sequences' are identified and distinguished only by their inehrent sequence, and not their position. Accordingly, the 'ATG' start codon in the coding DNA sequence of the human AKT gene is the same 'sequence' as the 'ATG' start codon in the human SHH gene, but these represent two distinct 'sequence features' in virtue of their different positions in the genome." ; rdfs:label "sequence_feature" ; rdfs:subClassOf obo:GENO_0000701, _:genid873, _:genid875 . obo:SO_0000143 obo:IAO_0000115 "A region of known length which may be used to manufacture a longer region." ; a owl:Class ; rdfs:label "obsolete assembly_component" ; owl:deprecated true . obo:SO_0000149 obo:IAO_0000111 "contig" ; obo:IAO_0000115 "A contiguous sequence derived from sequence assembly. Has no gaps, but may contain N's from unavailable bases." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "contig", "obsolete contig" ; rdfs:subClassOf obo:SO_0000353 ; owl:deprecated true . obo:SO_0000159 obo:IAO_0000115 "The point at which one or more contiguous nucleotides were excised." ; obo:IAO_0000118 "deleted_sequence", "nucleotide deletion", "nucleotide_deletion" ; obo:IAO_0000412 ; obo:IAO_alt_id "SO:1000033" ; obo:IAO_id "SO:0000159" ; obo:IAO_subset "SOFA" ; obo:IAO_xref "http://en.wikipedia.org/wiki/Nucleotide_deletion" ; a owl:Class ; rdfs:label "deletion" ; rdfs:subClassOf obo:SO_0001059, [ a owl:Restriction ; owl:hasValue 0 ; owl:onProperty obo:GENO_0000678 ] . obo:SO_0000165 a owl:Class ; rdfs:label "enhancer" ; rdfs:subClassOf obo:SO_0005836 . obo:SO_0000167 obo:IAO_0000115 "A regulatory_region composed of the TSS(s) and binding sites for TF_complexes of the basal transcription machinery." ; a owl:Class ; rdfs:label "promoter" ; rdfs:subClassOf obo:SO_0005836 . obo:SO_0000199 obo:IAO_0000115 "A region of nucleotide sequence that has translocated to a new position." ; obo:IAO_0000118 "transchr", "translocated sequence" ; obo:IAO_0000412 ; obo:IAO_id "SO:0000199" ; obo:IAO_subset "DBVAR" ; a owl:Class ; rdfs:label "translocation" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_0000207 obo:IAO_0000118 "SSLP", "simple sequence length polymorphism", "simple sequence length variation" ; obo:IAO_0000412 ; obo:IAO_id "SO:0000207" ; a owl:Class ; rdfs:label "simple_sequence_length_variation" ; rdfs:subClassOf obo:SO_0000248 . obo:SO_0000248 obo:IAO_0000118 "sequence length variation" ; obo:IAO_0000412 ; obo:IAO_id "SO:0000248" ; a owl:Class ; rdfs:label "sequence_length_variation" ; rdfs:subClassOf obo:SO_1000002 . obo:SO_0000281 obo:IAO_0000116 """See here for a list of engineered regions in ZFIN: http://zfin.org/cgi-bin/webdriver?MIval=aa-markerselect.apg&marker_type=REGION&query_results=t&compare=contains&WINSIZE=25. Includes things like loxP sites, inducible promoters, ires elements, etc.""" ; a owl:Class ; rdfs:label "engineered_foreign_gene" ; rdfs:subClassOf obo:SO_0000704, obo:SO_0000804 . obo:SO_0000289 obo:IAO_0000115 "A repeat_region containing repeat_units of 2 to 10 bp repeated in tandem." ; obo:IAO_0000119 "http://en.wikipedia.org/wiki/Microsatellite_%28genetics%29" ; a owl:Class ; rdfs:comment "A defined feature that includes any type of VNTR or SSLP locus." ; rdfs:label "microsatellite" ; rdfs:subClassOf obo:GENO_0000481 . obo:SO_0000337 a owl:Class ; rdfs:label "RNAi_reagent"@en ; rdfs:subClassOf obo:GENO_0000533 . obo:SO_0000340 obo:IAO_0000115 "Structural unit composed of a nucleic acid molecule which controls its own replication through the interaction of specific proteins at one or more origins of replication." ; a owl:Class ; rdfs:comment "A complete chromosome sequence." ; rdfs:label "chromosome" ; rdfs:subClassOf obo:GENO_0000481 . obo:SO_0000341 obo:IAO_0000112 "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." ; obo:IAO_0000115 "A cytologically distinguishable feature of a chromosome, often made visible by staining, and usually alternating light and dark." ; obo:IAO_0000119 """http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome > arm > region > band > sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome > arm > band > sub-band > sub-sub-band """ ; a owl:Class ; rdfs:comment "\"Band' is a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome > arm > region > band > sub-band." ; rdfs:label "chromosome band"@en ; rdfs:subClassOf obo:SO_0000830, [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:GENO_0000614 ], [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:GENO_0000618 ] . obo:SO_0000353 obo:IAO_0000111 "sequence_assembly" ; obo:IAO_0000115 "A sequence of nucleotides that has been algorithmically derived from an alignment of two or more different sequences." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "sequence_assembly" ; rdfs:subClassOf obo:SO_0001248 . obo:SO_0000577 a owl:Class ; rdfs:label "centromere"@en ; rdfs:subClassOf obo:SO_0000830 . obo:SO_0000637 obo:IAO_0000116 "Obsoleted as we didnt want to commit to constructs being plasmids - but rather wanted a classification of more general types of engineered regions used to replicate and deliver sequence to target cells/genomes. Replaced by GENO:0000856 ! engineered genetic construct." ; a owl:Class ; rdfs:label "obsolete engineered_plasmid" ; owl:deprecated true . obo:SO_0000667 obo:IAO_0000115 "The sequence of one or more nucleotides added between two adjacent nucleotides in the sequence." ; obo:IAO_0000118 "insertion", "nucleotide insertion", "nucleotide_insertion" ; obo:IAO_0000412 ; obo:IAO_alt_id "SO:1000034" ; obo:IAO_id "SO:0000667" ; obo:IAO_subset "DBVAR", "SOFA" ; a owl:Class ; rdfs:label "insertion" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_0000694 obo:IAO_0000115 "SNPs are single base pair positions in genomic DNA at which different sequence alternatives exist in normal individuals in some population(s), wherein the least frequent variant has an abundance of 1% or greater." ; obo:IAO_0000118 "single nucleotide polymorphism" ; obo:IAO_0000412 ; obo:IAO_id "SO:0000694" ; obo:IAO_subset "SOFA" ; a owl:Class ; rdfs:label "SNP" ; rdfs:subClassOf obo:SO_0001483 . obo:SO_0000699 a owl:Class ; rdfs:comment "A junction is a boundary between regions. A boundary has an extent of zero." ; rdfs:label "junction"@en ; rdfs:subClassOf obo:SO_0000110 . obo:SO_0000704 obo:IAO_0000115 "A region (or regions) that includes all of the sequence elements necessary to encode a functional transcript. A gene may include regulatory regions, transcribed regions and/or other functional sequence regions." ; obo:IAO_0000116 """Regarding the distinction between a 'gene' and a 'gene allele': Every zebrafish genome contains a 'gene allele' for every zebrafish gene. Many will be 'wild-type' or at least functional gene alleles. But some may be alleles that are mutated or truncated so as to lack functionality. According to current SO criteria defining genes, a 'gene' no longer exists in the case of a non-functional or deleted variant. But the 'gene allele' does exist - and its extent is that of the remaining/altered sequence based on alignment with a reference gene. Even for completely deleted genes, an allele of the gene exists (and here is equivalent to the junction corresponding to the where gene would live based on a reference alignment).""" ; a owl:Class ; rdfs:comment "A gene is any 'gene allele' that produces a functional transcript (ie one capable of translation into a protein, or independent functioning as an RNA), when encoded in the genome of some cell or virion." ; rdfs:label "gene" ; rdfs:subClassOf obo:GENO_0000481 . obo:SO_0000771 obo:IAO_0000115 "A quantitative trait locus (QTL) is a polymorphic locus which contains alleles that differentially affect the expression of a continuously distributed phenotypic trait. Usually it is a marker described by statistical association to quantitative variation in the particular phenotypic trait that is thought to be controlled by the cumulative action of alleles at multiple loci." ; obo:IAO_0000118 "quantitative trait locus" ; a owl:Class ; rdfs:label "QTL" ; rdfs:subClassOf obo:GENO_0000481 . obo:SO_0000783 obo:IAO_0000115 "An attribute to describe a region that was modified in vitro." ; a owl:Class ; rdfs:label "engineered" ; rdfs:subClassOf obo:GENO_0000788 . obo:SO_0000804 obo:IAO_0000118 "construct" ; a owl:Class ; rdfs:label "engineered_region"@en ; rdfs:subClassOf obo:SO_0000110, [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:SO_0000783 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:SO_0000110 [ a owl:Restriction ; owl:onProperty obo:GENO_0000207 ; owl:someValuesFrom obo:SO_0000783 ] ) ] . obo:SO_0000830 obo:IAO_0000115 "An extended region of sequence corresponding to a defined feature that is a proper part of a chromosome, e.g. a chromosomal 'arm', 'region', or 'band'." ; obo:IAO_0000118 "chromosomal feature", "gross chromosomal part" ; a owl:Class ; rdfs:label "chromosome part" ; rdfs:subClassOf obo:GENO_0000481, [ a owl:Restriction ; owl:onProperty obo:GENO_0000248 ; owl:someValuesFrom obo:SO_0000340 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000481 [ a owl:Restriction ; owl:onProperty obo:GENO_0000248 ; owl:someValuesFrom obo:SO_0000340 ] ) ] . obo:SO_0000902 obo:IAO_0000115 "A gene that has been transferred naturally or by any of a number of genetic engineering techniques into a cell or organism where it is foreign (i.e. does not belong to the host genome)." ; a owl:Class ; rdfs:comment """On the relationship between 'transgenic insertions', 'transgenes', and 'alleles' Transgenic insertions are sequence alterations comprised of foreign/exogenous sequence. This sequence can be from the same or different species as the host cell or genome - it is exogenous in virtue of it being additional sequence inserted into the original host genome. A given transgenic insertion may create one or more transgenes when introduced into a host genome. The extent of a transgene is spans all features needed to drive its expression in the host genome. In most cases a transgenic insertion completely contains one or more transgenes that are fully competent to drive expression in the host genome. But in some cases, a transgenic insertion may carry only part of the final transgene it creates - which requires additional endogenous sequences in the vicinity of its insertion site to complete a functional gene (e.g. this is the case for enhancer traps or gene traps) to complete. In addition to the transgenes they create upon genomic integration, transgenic insertions can create variant alleles by disrupting a known endogenous gene/locus. Variant alleles are versions of a particular genomic features (typically genes), that are altered in their sequence relative to some reference. An insertion that disrupts an endogenous gene would be considered a 'sequence alteration' (sensu SO) which creates a 'variant gene allele'. From the perspective of this disrupted gene, the origin or transgenic nature of this insertion is irrelevant - what matters here is that the gene's sequence has been altered to create an allele. For the purposes of modeling, any transgene(s) created when an endogenous gene is interrupted by an insertion is considered/modeled separately from the allele of the endogenous gene that is created by the insertion. The transgenic insertion, which is simply a sequence alteration in the host genome, is then linked to any transgenes that it contributes to or overlaps with or contains. The model of the Flybase example HERE illustrates this approach.""", """Transgenes can exist as integrated into the host genome, or extra-chromosomally on replicons or transiently carried/expressed vectors. What matters is that they are active in the context of a foreign biological system (typically a cell or organism). Note that transgenes as defined here are not necessarily from a different taxon than that of the host genome. For example, a Mus musculus gene over-expressed from a chromosomally-integrated expression construct in a Mus musculus genome qualifies as a transgene because it is exogenous to the host genome.""" ; rdfs:label "transgene"@en ; rdfs:subClassOf obo:SO_0000704 . obo:SO_0001013 obo:IAO_0000115 "A multiple nucleotide polymorphism with alleles of common length > 1, for example AAA/TTT." ; obo:IAO_0000118 "multiple nucleotide polymorphism" ; obo:IAO_0000412 ; obo:IAO_id "SO:0001013" ; a owl:Class ; rdfs:label "MNP" ; rdfs:subClassOf obo:SO_1000002 . obo:SO_0001019 obo:IAO_0000115 "A variation that increases or decreases the copy number of a given region." ; obo:IAO_0000118 "CNP", "CNV", "copy number polymorphism", "copy number variation" ; obo:IAO_0000412 ; obo:IAO_id "SO:0001019" ; obo:IAO_subset "SOFA" ; obo:IAO_xref "http://en.wikipedia.org/wiki/Copy_number_variation" ; a owl:Class ; rdfs:label "copy_number_variation" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_0001026 obo:IAO_0000115 "A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where 'genetic material' refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny)" ; obo:IAO_0000116 "Genotype vs Genome in GENO: An (genomic) genotype is an information artifact representing a shorthand syntax for specifying what is known about variation in a genome sequence. This syntax has reference and variant components - a 'reference genome' and 'genomic variation complement' - that must be operated on to resolve a final genome sequence (i.e. substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the 'reference genome'). So, while the total sequence content represented in a genotype may be greater than that in a genome, the intended resolution of these sequences is to arrive at a single genome sequence." ; obo:IAO_0000118 "'genome sequence'" ; a owl:Class ; rdfs:comment "A genome is considered the complement of all heritable sequence features in a given cell or organism (chromosomal or extrachromosomal). This is typically a collection of >1 sequence molecules (e.g. chromosomes), but in some organisms (e.g. bacteria) it may be a single sequence macromolecule (e.g. a circular plasmid). For this reason 'genome' classifies under 'sequence feature complement'." ; rdfs:label "genome" ; rdfs:subClassOf obo:GENO_0000660 . obo:SO_0001059 obo:IAO_0000112 """A few examples highlighting the distinction of 'sequence alterations' from their parent 'variant allele': 1. Consider NM_000059.3(BRCA2):c.631G>A variation in the BRCA2 gene. This mutation of a single nucleotide creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a 'variant allele', while the extent of sequence spanning just the single altered base is a 'sequence alteration'. See https://www.ncbi.nlm.nih.gov/snp/80358871. 2. Consider the NM_000059.3(BRCA2):c.132_133ins8 variation in the BRCA2 gene. This 8 bp insertion creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a 'variant allele', while the extent of sequence spanning just the 8 bp insertion is a 'sequence alteration'. See https://www.ncbi.nlm.nih.gov/snp/483353112. 3. Consider the NM_000059.3(BRCA2):c.22_23delAG variation in the BRCA2 gene. This 2 bp deletion creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a 'variant allele', while the junction where the deletion occured is a 'sequence alteration' with an extent of zero. See https://www.ncbi.nlm.nih.gov/snp/483353112.""" ; obo:IAO_0000115 "A sequence_alteration is a sequence_feature whose extent is the deviation from another sequence." ; obo:IAO_0000118 "sequence variation" ; obo:IAO_0000412 ; obo:IAO_alt_id "SO:1000004", "SO:1000007" ; obo:IAO_id "SO:0001059" ; obo:IAO_subset "SOFA" ; a owl:Class ; rdfs:comment """1. A 'sequence alteration' is an allele whose sequence deviates in its entirety from that of other features found at the same genomic location (i.e. it deviates along its entire extent). In this sense, 'sequence alterations' represent the minimal extent an allele can take - i.e. that which is variable with some other feature along its entire sequence). An example is a SNP or insertion. Alleles whose extent goes beyond the specific sequence that is known to be variable are not sequence alterations. These are alleles that represent alternate versions of some larger, named feature. The classic example here is a 'gene allele', which spans the extent of an entire gene, and contains one or more sequence alterations (regions known to vary) as part. 2. Sequence alterations are not necessarily 'variant' in the sense defined in GENO (i.e. being 'variant with' some reference sequence). In any comparison of alleles at a particular location, the choice of a 'reference' is context-dependent - as comparisons in other contexts might consider a different allele to be the reference. So while sequence alterations are usually considered 'variant' in the context in which they are considered, this variant status may not hold at all times. For this reason, the 'sequence alteration' class is not made an rdfs:subClassOf 'variant allele'. For a particular instance of a sequence alteration, howver, we may in some cases be able to rdf:type it as a 'varaint allele' and a 'sequence alteration', in situations where we can be confident that the feature will *never* be considered a reference. For example, experimentally generated mutations in model organism genes that are created expressly to vary from an established reference. 3. Note that we consider novel features gained in a genome to be sequence alterations, including aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that become part of the heritable genome of a cell or organism.""" ; rdfs:label "sequence_alteration" ; rdfs:subClassOf obo:GENO_0000512, [ a owl:Restriction ; owl:onProperty obo:GENO_0000784 ; owl:someValuesFrom obo:GENO_0000481 ] ; owl:equivalentClass [ a owl:Class ; owl:intersectionOf (obo:GENO_0000512 [ a owl:Restriction ; owl:onProperty obo:GENO_0000784 ; owl:someValuesFrom obo:GENO_0000481 ] ) ] . obo:SO_0001218 obo:IAO_0000115 "An insertion that derives from another organism, via the use of recombinant DNA technology." ; obo:IAO_0000118 "transgenic insertion" ; obo:IAO_0000412 ; obo:IAO_id "SO:0001218" ; a owl:Class ; rdfs:label "transgenic_insertion" ; rdfs:subClassOf obo:SO_0000667, [ a owl:Restriction ; owl:onProperty obo:BFO_0000051 ; owl:someValuesFrom obo:GENO_0000093 ] . obo:SO_0001248 obo:IAO_0000111 "assembly" ; obo:IAO_0000115 "A region of the genome of known length that is composed by ordering and aligning two or more different regions." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "assembly" ; rdfs:subClassOf obo:SO_0001410 . obo:SO_0001410 obo:IAO_0000111 "experimental_feature" ; obo:IAO_0000115 "A region which is the result of some arbitrary experimental procedure. The procedure may be carried out with biological material or inside a computer." ; obo:IAO_0000231 "not currently needed to support modeling use cases. can re-introduce if becomes necessary." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "experimental_feature", "obsolete experimental_feature" ; rdfs:subClassOf obo:SO_0000001 ; owl:deprecated true . obo:SO_0001477 obo:IAO_0000115 "A construct which is designed to integrate into a genome and produce a fusion transcript between exons of the gene into which it inserts and a reporter element in the construct. Gene traps contain a splice acceptor, do not contain promoter elements for the reporter, and are mutagenic. Gene traps may be bicistronic with the second cassette containing a promoter driving an a selectable marker." ; a owl:Class ; rdfs:label "gene_trap_construct"@en ; rdfs:subClassOf obo:GENO_0000856 . obo:SO_0001478 obo:IAO_0000115 "A construct which is designed to integrate into a genome and express a reporter when inserted in close proximity to a promoter element. Promoter traps typically do not contain promoter elements and are mutagenic." ; a owl:Class ; rdfs:label "promoter_trap_construct"@en ; rdfs:subClassOf obo:GENO_0000856 . obo:SO_0001479 obo:IAO_0000115 "A construct which is designed to integrate into a genome and express a reporter when the expression from a basic minimal promoter is enhanced by genomic enhancer elements. Enhancer traps contain promoter elements and are not usually mutagenic." ; a owl:Class ; rdfs:label "enhancer_trap_construct"@en ; rdfs:subClassOf obo:GENO_0000856 . obo:SO_0001483 obo:IAO_0000115 "SNVs are single base pair positions in genomic DNA at which different sequence alternatives exist." ; obo:IAO_0000118 "single nucleotide variant" ; obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Thu Oct 08 11:37:49 PDT 2009" ; obo:IAO_id "SO:0001483" ; obo:IAO_subset "SOFA" ; a owl:Class ; rdfs:label "SNV" ; rdfs:subClassOf obo:SO_1000002 . obo:SO_0001500 obo:IAO_0000115 "A biological_region characterized as a single heritable trait in a phenotype screen. The heritable phenotype may be mapped to a chromosome but generally has not been characterized to a specific gene locus." ; a owl:Class ; rdfs:label "heritable_phenotypic_marker"@en ; rdfs:subClassOf obo:GENO_0000481 . obo:SO_0001505 obo:IAO_0000112 "'GRCh37.p10' (a human reference genome build)" ; obo:IAO_0000115 "A genome sequence that is used as a standard against which other genome sequences are compared, or into which alterations are intentionally introduced." ; a owl:Class ; rdfs:label "reference genome sequence" ; rdfs:subClassOf obo:GENO_0000017 . obo:SO_0001742 obo:IAO_0000115 "A sequence alteration whereby the copy number of a given regions is greater than the reference sequence." ; obo:IAO_0000118 "copy number gain", "gain" ; obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Mon Feb 28 01:54:09 PST 2011" ; obo:IAO_id "SO:0001742" ; obo:IAO_subset "DBVAR" ; a owl:Class ; rdfs:label "copy_number_gain" ; rdfs:subClassOf obo:SO_0001019 . obo:SO_0001743 obo:IAO_0000115 "A sequence alteration whereby the copy number of a given region is less than the reference sequence." ; obo:IAO_0000118 "copy number loss", "loss" ; obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Mon Feb 28 01:55:02 PST 2011" ; obo:IAO_id "SO:0001743" ; obo:IAO_subset "DBVAR" ; a owl:Class ; rdfs:label "copy_number_loss" ; rdfs:subClassOf obo:SO_0001019 . obo:SO_0001744 obo:IAO_0000115 "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from one parent and no copies of the same chromosome or region from the other parent." ; obo:IAO_0000118 "UPD", "uniparental disomy" ; obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Mon Feb 28 02:01:05 PST 2011" ; obo:IAO_id "SO:0001744" ; obo:IAO_subset "DBVAR" ; obo:IAO_xref "http:http\\://en.wikipedia.org/wiki/Uniparental_disomy" ; a owl:Class ; rdfs:label "UPD" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_0001745 obo:IAO_0000115 "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the mother and no copies of the same chromosome or region from the father." ; obo:IAO_0000118 "maternal uniparental disomy" ; obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Mon Feb 28 02:03:01 PST 2011" ; obo:IAO_id "SO:0001745" ; a owl:Class ; rdfs:label "maternal_uniparental_disomy" ; rdfs:subClassOf obo:SO_0001744 . obo:SO_0001746 obo:IAO_0000115 "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the father and no copies of the same chromosome or region from the mother." ; obo:IAO_0000118 "paternal uniparental disomy" ; obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Mon Feb 28 02:03:30 PST 2011" ; obo:IAO_id "SO:0001746" ; a owl:Class ; rdfs:label "paternal_uniparental_disomy" ; rdfs:subClassOf obo:SO_0001744 . obo:SO_0001784 obo:IAO_0000115 "A structural sequence alteration where there are multiple equally plausible explanations for the change." ; obo:IAO_0000118 "complex" ; obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Wed Mar 23 03:21:19 PDT 2011" ; obo:IAO_id "SO:0001784" ; obo:IAO_subset "DBVAR" ; a owl:Class ; rdfs:label "complex_structural_alteration" ; rdfs:subClassOf obo:SO_0001785 . obo:SO_0001785 obo:IAO_0000412 ; obo:IAO_created_by "kareneilbeck" ; obo:IAO_creation_date "Fri Mar 25 02:27:41 PDT 2011" ; obo:IAO_id "SO:0001785" ; obo:IAO_subset "DBVAR" ; a owl:Class ; rdfs:label "structural_alteration" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_0005836 obo:IAO_0000111 "regulatory_region" ; obo:IAO_0000115 "A region of sequence that is involved in the control of a biological process." ; obo:IAO_0000116 "Formerly http://purl.obolibrary.org/obo/GENO_0000067, replaced with SO term." ; obo:IAO_0000118 "regulatory element", "regulatory gene region" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "regulatory_region" ; rdfs:subClassOf obo:GENO_0000666, obo:SO_0000001 . obo:SO_1000002 obo:IAO_0000115 "Any change in genomic DNA caused by a single event." ; obo:IAO_0000412 ; obo:IAO_id "SO:1000002" ; obo:IAO_subset "SOFA" ; a owl:Class ; rdfs:label "substitution" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_1000005 obo:IAO_0000115 "When no simple or well defined DNA mutation event describes the observed DNA change, the keyword \\\"complex\\\" should be used. Usually there are multiple equally plausible explanations for the change." ; obo:IAO_0000118 "complex substitution" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000005" ; obo:IAO_subset "SOFA" ; a owl:Class ; rdfs:label "complex_substitution" ; rdfs:subClassOf obo:SO_1000002 . obo:SO_1000008 obo:IAO_0000115 "A single nucleotide change which has occurred at the same position of a corresponding nucleotide in a reference sequence." ; obo:IAO_0000118 "point mutation" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000008" ; obo:IAO_subset "SOFA" ; obo:IAO_xref "http://en.wikipedia.org/wiki/Point_mutation" ; a owl:Class ; rdfs:label "point_mutation" ; rdfs:subClassOf obo:SO_0001483 . obo:SO_1000009 obo:IAO_0000115 "Change of a pyrimidine nucleotide, C or T, into an other pyrimidine nucleotide, or change of a purine nucleotide, A or G, into an other purine nucleotide." ; obo:IAO_0000412 ; obo:IAO_id "SO:1000009" ; a owl:Class ; rdfs:label "transition" ; rdfs:subClassOf obo:SO_0001483 . obo:SO_1000010 obo:IAO_0000115 "A substitution of a pyrimidine, C or T, for another pyrimidine." ; obo:IAO_0000118 "pyrimidine transition" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000010" ; a owl:Class ; rdfs:label "pyrimidine_transition" ; rdfs:subClassOf obo:SO_1000009 . obo:SO_1000011 obo:IAO_0000115 "A transition of a cytidine to a thymine." ; obo:IAO_0000118 "C to T transition" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000011" ; a owl:Class ; rdfs:label "C_to_T_transition" ; rdfs:subClassOf obo:SO_1000010 . obo:SO_1000012 obo:IAO_0000115 "The transition of cytidine to thymine occurring at a pCpG site as a consequence of the spontaneous deamination of 5'-methylcytidine." ; obo:IAO_0000118 "C to T transition at pCpG site" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000012" ; a owl:Class ; rdfs:label "C_to_T_transition_at_pCpG_site" ; rdfs:subClassOf obo:SO_1000011 . obo:SO_1000013 obo:IAO_0000118 "T to C transition" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000013" ; a owl:Class ; rdfs:label "T_to_C_transition" ; rdfs:subClassOf obo:SO_1000010 . obo:SO_1000014 obo:IAO_0000115 "A substitution of a purine, A or G, for another purine." ; obo:IAO_0000118 "purine transition" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000014" ; a owl:Class ; rdfs:label "purine_transition" ; rdfs:subClassOf obo:SO_1000009 . obo:SO_1000015 obo:IAO_0000115 "A transition of an adenine to a guanine." ; obo:IAO_0000118 "A to G transition" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000015" ; a owl:Class ; rdfs:label "A_to_G_transition" ; rdfs:subClassOf obo:SO_1000014 . obo:SO_1000016 obo:IAO_0000115 "A transition of a guanine to an adenine." ; obo:IAO_0000118 "G to A transition" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000016" ; a owl:Class ; rdfs:label "G_to_A_transition" ; rdfs:subClassOf obo:SO_1000014 . obo:SO_1000017 obo:IAO_0000115 "Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G, or vice versa." ; obo:IAO_0000412 ; obo:IAO_id "SO:1000017" ; obo:IAO_xref "http://en.wikipedia.org/wiki/Transversion" ; a owl:Class ; rdfs:label "transversion" ; rdfs:subClassOf obo:SO_0001483 . obo:SO_1000018 obo:IAO_0000115 "Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G." ; obo:IAO_0000118 "pyrimidine to purine transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000018" ; a owl:Class ; rdfs:label "pyrimidine_to_purine_transversion" ; rdfs:subClassOf obo:SO_1000017 . obo:SO_1000019 obo:IAO_0000115 "A transversion from cytidine to adenine." ; obo:IAO_0000118 "C to A transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000019" ; a owl:Class ; rdfs:label "C_to_A_transversion" ; rdfs:subClassOf obo:SO_1000018 . obo:SO_1000020 obo:IAO_0000118 "C to G transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000020" ; a owl:Class ; rdfs:label "C_to_G_transversion" ; rdfs:subClassOf obo:SO_1000018 . obo:SO_1000021 obo:IAO_0000115 "A transversion from T to A." ; obo:IAO_0000118 "T to A transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000021" ; a owl:Class ; rdfs:label "T_to_A_transversion" ; rdfs:subClassOf obo:SO_1000018 . obo:SO_1000022 obo:IAO_0000115 "A transversion from T to G." ; obo:IAO_0000118 "T to G transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000022" ; a owl:Class ; rdfs:label "T_to_G_transversion" ; rdfs:subClassOf obo:SO_1000018 . obo:SO_1000023 obo:IAO_0000115 "Change of a purine nucleotide, A or G , into a pyrimidine nucleotide C or T." ; obo:IAO_0000118 "purine to pyrimidine transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000023" ; a owl:Class ; rdfs:label "purine_to_pyrimidine_transversion" ; rdfs:subClassOf obo:SO_1000017 . obo:SO_1000024 obo:IAO_0000115 "A transversion from adenine to cytidine." ; obo:IAO_0000118 "A to C transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000024" ; a owl:Class ; rdfs:label "A_to_C_transversion" ; rdfs:subClassOf obo:SO_1000023 . obo:SO_1000025 obo:IAO_0000115 "A transversion from adenine to thymine." ; obo:IAO_0000118 "A to T transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000025" ; a owl:Class ; rdfs:label "A_to_T_transversion" ; rdfs:subClassOf obo:SO_1000023 . obo:SO_1000026 obo:IAO_0000115 "A transversion from guanine to cytidine." ; obo:IAO_0000118 "G to C transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000026" ; a owl:Class ; rdfs:label "G_to_C_transversion" ; rdfs:subClassOf obo:SO_1000023 . obo:SO_1000027 obo:IAO_0000115 "A transversion from guanine to thymine." ; obo:IAO_0000118 "G to T transversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000027" ; a owl:Class ; rdfs:label "G_to_T_transversion" ; rdfs:subClassOf obo:SO_1000023 . obo:SO_1000032 obo:IAO_0000115 "A sequence alteration which included an insertion and a deletion, affecting 2 or more bases." ; obo:IAO_0000412 ; obo:IAO_id "SO:1000032" ; obo:IAO_xref "http://en.wikipedia.org/wiki/Indel" ; a owl:Class ; rdfs:comment "Indels can have a different number of bases than the corresponding reference sequence." ; rdfs:label "indel" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_1000035 obo:IAO_0000115 "One or more nucleotides are added between two adjacent nucleotides in the sequence; the inserted sequence derives from, or is identical in sequence to, nucleotides adjacent to insertion point." ; obo:IAO_0000118 "nucleotide duplication", "nucleotide_duplication" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000035" ; a owl:Class ; rdfs:label "duplication" ; rdfs:subClassOf obo:SO_0000667 . obo:SO_1000036 obo:IAO_0000115 "A continuous nucleotide sequence is inverted in the same position." ; obo:IAO_0000118 "inversion" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000036" ; obo:IAO_subset "DBVAR", "SOFA" ; a owl:Class ; rdfs:label "inversion" ; rdfs:subClassOf obo:SO_0001059 . obo:SO_1000039 obo:IAO_0000115 "A tandem duplication where the individual regions are in the same orientation." ; obo:IAO_0000118 "direct tandem duplication" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000039" ; a owl:Class ; rdfs:label "direct_tandem_duplication" ; rdfs:subClassOf obo:SO_1000173 . obo:SO_1000040 obo:IAO_0000115 "A tandem duplication where the individual regions are not in the same orientation." ; obo:IAO_0000118 "inverted tandem duplication", "mirror duplication" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000040" ; a owl:Class ; rdfs:label "inverted_tandem_duplication" ; rdfs:subClassOf obo:SO_1000173 . obo:SO_1000173 obo:IAO_0000115 "A duplication consisting of 2 identical adjacent regions." ; obo:IAO_0000118 "erverted", "tandem duplication" ; obo:IAO_0000412 ; obo:IAO_id "SO:1000173" ; obo:IAO_subset "DBVAR" ; a owl:Class ; rdfs:label "tandem_duplication" ; rdfs:subClassOf obo:SO_1000035 . obo:UBERON_0000061 obo:IAO_0000115 "Material anatomical entity that is a single connected structure with inherent 3D shape generated by coordinated expression of the organism's own genome." ; oboInOwl:hasDbXref "AAO:0010825", "AEO:0000003", "BILA:0000003", "CARO:0000003", "EHDAA2:0003003", "EMAPA:0", "FMA:305751", "FMA:67135", "GAID:781", "HAO:0000003", "MA:0003000", "MESH:D000825", "SCTID:362889002", "TAO:0000037", "TGMA:0001823", "VHOG:0001759", "XAO:0003000", "ZFA:0000037", "http://dbpedia.org/ontology/AnatomicalStructure" ; a owl:Class ; rdfs:label "anatomical structure" ; rdfs:subClassOf obo:UBERON_0000465 . obo:UBERON_0000105 obo:IAO_0000111 "life cycle stage" ; obo:IAO_0000115 "A spatiotemporal region encompassing some part of the life cycle of an organism." ; obo:IAO_0000116 "Stub class to serve as root of hierarchy for imports of developmental stages from Uberon or taxon specific vocabularies such as ZFIN stages terms)" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "life cycle stage" ; rdfs:subClassOf obo:GENO_0000351, obo:GO_0008150 . obo:UBERON_0000465 obo:IAO_0000115 "Anatomical entity that has mass." ; oboInOwl:hasDbXref "AAO:0010264", "AEO:0000006", "BILA:0000006", "CARO:0000006", "EHDAA2:0003006", "FMA:67165", "HAO:0000006", "TAO:0001836", "TGMA:0001826", "VHOG:0001721" ; a owl:Class ; rdfs:label "material anatomical entity" ; rdfs:subClassOf obo:UBERON_0001062 . obo:UBERON_0001062 obo:IAO_0000115 "Biological entity that is either an individual member of a biological species or constitutes the structural organization of an individual member of a biological species." ; obo:IAO_0000116 "Stub class to serve as root of hierarchy for imports of anatomical entities from UBERON, CARO, or taxon-specific anatomy ontologies." ; oboInOwl:hasDbXref "AAO:0010841", "AEO:0000000", "BFO:0000004", "BILA:0000000", "BIRNLEX:6", "CARO:0000000", "EHDAA2:0002229", "FMA:62955", "HAO:0000000", "MA:0000001", "NCIT:C12219", "TAO:0100000", "TGMA:0001822", "WBbt:0000100", "XAO:0000000", "ZFA:0100000", "http://purl.obolibrary.org/obo/CARO_0000000" ; a owl:Class ; rdfs:label "anatomical entity" ; rdfs:subClassOf obo:GENO_0000904, [ a owl:Restriction ; owl:onProperty obo:RO_0001000 ; owl:someValuesFrom obo:OBI_0100026 ] ; owl:equivalentClass [ a owl:Restriction ; owl:hasSelf true ; owl:onProperty obo:RO_0020105 ] . obo:UO_0000001 obo:IAO_0000111 "length unit" ; obo:IAO_0000115 "A unit which is a standard measure of the distance between two points." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "length unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000002 obo:IAO_0000111 "mass unit" ; obo:IAO_0000115 "A unit which is a standard measure of the amount of matter/energy of a physical object." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "mass unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000003 obo:IAO_0000111 "time unit" ; obo:IAO_0000115 "A unit which is a standard measure of the dimension in which events occur in sequence." ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "time unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000005 obo:IAO_0000111 "temperature unit" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "temperature unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000006 obo:IAO_0000111 "substance unit" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "substance unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000008 obo:IAO_0000111 "meter" ; obo:IAO_0000115 "A length unit which is equal to the length of the path traveled by light in vacuum during a time interval of 1/299 792 458 of a second." ; obo:IAO_0000118 "m" ; obo:IAO_0000412 ; a obo:UO_0000001, owl:NamedIndividual ; rdfs:label "meter" . obo:UO_0000009 obo:IAO_0000111 "kilogram" ; obo:IAO_0000115 "A mass unit which is equal to the mass of the International Prototype Kilogram kept by the BIPM at Svres, France." ; obo:IAO_0000118 "kg" ; obo:IAO_0000412 ; a obo:UO_0000002, owl:NamedIndividual ; rdfs:label "kilogram" . obo:UO_0000010 obo:IAO_0000111 "second" ; obo:IAO_0000115 "A time unit which is equal to the duration of 9 192 631 770 periods of the radiation corresponding to the transition between the two hyperfine levels of the ground state of the caesium 133 atom." ; obo:IAO_0000118 "s", "sec" ; obo:IAO_0000412 ; a obo:UO_0000003, owl:NamedIndividual ; rdfs:label "second" . obo:UO_0000015 obo:IAO_0000111 "centimeter" ; obo:IAO_0000115 "A length unit which is equal to one hundredth of a meter or 10^[-2] m." ; obo:IAO_0000118 "cm" ; obo:IAO_0000412 ; a obo:UO_0000001, owl:NamedIndividual ; rdfs:label "centimeter" . obo:UO_0000016 obo:IAO_0000111 "millimeter" ; obo:IAO_0000115 "A length unit which is equal to one thousandth of a meter or 10^[-3] m." ; obo:IAO_0000118 "mm" ; obo:IAO_0000412 ; a obo:UO_0000001, owl:NamedIndividual ; rdfs:label "millimeter" . obo:UO_0000017 obo:IAO_0000111 "micrometer" ; obo:IAO_0000115 "A length unit which is equal to one millionth of a meter or 10^[-6] m." ; obo:IAO_0000118 "um" ; obo:IAO_0000412 ; a obo:UO_0000001, owl:NamedIndividual ; rdfs:label "micrometer" . obo:UO_0000018 obo:IAO_0000111 "nanometer" ; obo:IAO_0000115 "A length unit which is equal to one thousandth of one millionth of a meter or 10^[-9] m." ; obo:IAO_0000118 "nm" ; obo:IAO_0000412 ; a obo:UO_0000001, owl:NamedIndividual ; rdfs:label "nanometer" . obo:UO_0000019 obo:IAO_0000111 "angstrom" ; obo:IAO_0000115 "A length unit which is equal to 10 [-10] m." ; obo:IAO_0000412 ; a obo:UO_0000001, owl:NamedIndividual ; rdfs:label "angstrom" . obo:UO_0000021 obo:IAO_0000111 "gram" ; obo:IAO_0000115 "A mass unit which is equal to one thousandth of a kilogram or 10^[-3] kg." ; obo:IAO_0000118 "g" ; obo:IAO_0000412 ; a obo:UO_0000002, owl:NamedIndividual ; rdfs:label "gram" . obo:UO_0000022 obo:IAO_0000111 "milligram" ; obo:IAO_0000115 "A mass unit which is equal to one thousandth of a gram or 10^[-3] g." ; obo:IAO_0000118 "mg" ; obo:IAO_0000412 ; a obo:UO_0000002, owl:NamedIndividual ; rdfs:label "milligram" . obo:UO_0000023 obo:IAO_0000111 "microgram" ; obo:IAO_0000115 "A mass unit which is equal to one millionth of a gram or 10^[-6] g." ; obo:IAO_0000118 "ug" ; obo:IAO_0000412 ; a obo:UO_0000002, owl:NamedIndividual ; rdfs:label "microgram" . obo:UO_0000024 obo:IAO_0000111 "nanogram" ; obo:IAO_0000115 "A mass unit which is equal to one thousandth of one millionth of a gram or 10^[-9] g." ; obo:IAO_0000118 "ng" ; obo:IAO_0000412 ; a obo:UO_0000002, owl:NamedIndividual ; rdfs:label "nanogram" . obo:UO_0000025 obo:IAO_0000111 "picogram" ; obo:IAO_0000115 "A mass unit which is equal to 10^[-12] g." ; obo:IAO_0000118 "pg" ; obo:IAO_0000412 ; a obo:UO_0000002, owl:NamedIndividual ; rdfs:label "picogram" . obo:UO_0000027 obo:IAO_0000111 "degree Celsius" ; obo:IAO_0000115 "A temperature unit which is equal to one kelvin degree. However, they have their zeros at different points. The centigrade scale has its zero at 273.15 K." ; obo:IAO_0000118 "C", "degree C" ; obo:IAO_0000412 ; a obo:UO_0000005, owl:NamedIndividual ; rdfs:label "degree Celsius" . obo:UO_0000031 obo:IAO_0000111 "minute" ; obo:IAO_0000115 "A time unit which is equal to 60 seconds." ; obo:IAO_0000118 "min" ; obo:IAO_0000412 ; a obo:UO_0000003, owl:NamedIndividual ; rdfs:label "minute" . obo:UO_0000032 obo:IAO_0000111 "hour" ; obo:IAO_0000115 "A time unit which is equal to 3600 seconds or 60 minutes." ; obo:IAO_0000118 "h", "hr" ; obo:IAO_0000412 ; a obo:UO_0000003, owl:NamedIndividual ; rdfs:label "hour" . obo:UO_0000033 obo:IAO_0000111 "day" ; obo:IAO_0000115 "A time unit which is equal to 24 hours." ; obo:IAO_0000412 ; a obo:UO_0000003, owl:NamedIndividual ; rdfs:label "day" . obo:UO_0000034 obo:IAO_0000111 "week" ; obo:IAO_0000115 "A time unit which is equal to 7 days." ; obo:IAO_0000412 ; a obo:UO_0000003, owl:NamedIndividual ; rdfs:label "week" . obo:UO_0000035 obo:IAO_0000111 "month" ; obo:IAO_0000115 "A time unit which is approximately equal to the length of time of one of cycle of the moon's phases which in science is taken to be equal to 30 days." ; obo:IAO_0000412 ; a obo:UO_0000003, owl:NamedIndividual ; rdfs:label "month" . obo:UO_0000036 obo:IAO_0000111 "year" ; obo:IAO_0000115 "A time unit which is equal to 12 months which is science is taken to be equal to 365.25 days." ; obo:IAO_0000412 ; a obo:UO_0000003, owl:NamedIndividual ; rdfs:label "year" . obo:UO_0000039 obo:IAO_0000111 "micromole" ; obo:IAO_0000115 "A substance unit equal to a millionth of a mol or 10^[-6] mol." ; obo:IAO_0000118 "umol" ; obo:IAO_0000412 ; a obo:UO_0000006, owl:NamedIndividual ; rdfs:label "micromole" . obo:UO_0000041 obo:IAO_0000111 "nanomole" ; obo:IAO_0000115 "A substance unit equal to one thousandth of one millionth of a mole or 10^[-9] mol." ; obo:IAO_0000118 "nmol" ; obo:IAO_0000412 ; a obo:UO_0000006, owl:NamedIndividual ; rdfs:label "nanomole" . obo:UO_0000042 obo:IAO_0000111 "picomole" ; obo:IAO_0000115 "A substance unit equal to 10^[-12] mol." ; obo:IAO_0000118 "pmol" ; obo:IAO_0000412 ; a obo:UO_0000006, owl:NamedIndividual ; rdfs:label "picomole" . obo:UO_0000051 obo:IAO_0000111 "concentration unit" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "concentration unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000062 obo:IAO_0000111 "molar" ; obo:IAO_0000115 "A unit of concentration which expresses a concentration of 1 mole of solute per liter of solution (mol/L)." ; obo:IAO_0000118 "M" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "molar" . obo:UO_0000063 obo:IAO_0000111 "millimolar" ; obo:IAO_0000115 "A unit of molarity which is equal to one thousandth of a molar or 10^[-3] M." ; obo:IAO_0000118 "mM" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "millimolar" . obo:UO_0000064 obo:IAO_0000111 "micromolar" ; obo:IAO_0000115 "A unit of molarity which is equal to one millionth of a molar or 10^[-6] M." ; obo:IAO_0000118 "uM" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "micromolar" . obo:UO_0000065 obo:IAO_0000111 "nanomolar" ; obo:IAO_0000115 "A unit of molarity which is equal to one thousandth of one millionth of a molar or 10^[-9] M." ; obo:IAO_0000118 "nM" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "nanomolar" . obo:UO_0000066 obo:IAO_0000111 "picomolar" ; obo:IAO_0000115 "A unit of molarity which is equal to 10^[-12] M." ; obo:IAO_0000118 "pM" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "picomolar" . obo:UO_0000095 obo:IAO_0000111 "volume unit" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "volume unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000097 obo:IAO_0000111 "cubic centimeter" ; obo:IAO_0000115 "A volume unit which is equal to one millionth of a cubic meter or 10^[-9] m^[3], or to 1 ml." ; obo:IAO_0000118 "cc" ; obo:IAO_0000412 ; a obo:UO_0000095, owl:NamedIndividual ; rdfs:label "cubic centimeter" . obo:UO_0000098 obo:IAO_0000111 "milliliter" ; obo:IAO_0000115 "A volume unit which is equal to one thousandth of a liter or 10^[-3] L, or to 1 cubic centimeter." ; obo:IAO_0000118 "ml" ; obo:IAO_0000412 ; a obo:UO_0000095, owl:NamedIndividual ; rdfs:label "milliliter" . obo:UO_0000099 obo:IAO_0000111 "liter" ; obo:IAO_0000115 "A volume unit which is equal to one thousandth of a cubic meter or 10^[-3] m^[3], or to 1 decimeter." ; obo:IAO_0000118 "L" ; obo:IAO_0000412 ; a obo:UO_0000095, owl:NamedIndividual ; rdfs:label "liter" . obo:UO_0000100 obo:IAO_0000111 "cubic decimeter" ; obo:IAO_0000115 "A volume unit which is equal to one thousand of a cubic meter or 10^[-3] m^[3], or to 1 L." ; obo:IAO_0000412 ; a obo:UO_0000095, owl:NamedIndividual ; rdfs:label "cubic decimeter" . obo:UO_0000101 obo:IAO_0000111 "microliter" ; obo:IAO_0000115 "A volume unit which is equal to one millionth of a liter or 10^[-6] L." ; obo:IAO_0000118 "ul" ; obo:IAO_0000412 ; a obo:UO_0000095, owl:NamedIndividual ; rdfs:label "microliter" . obo:UO_0000102 obo:IAO_0000111 "nanoliter" ; obo:IAO_0000115 "A volume unit which is equal to one thousandth of one millionth of a liter or 10^[-9] L." ; obo:IAO_0000118 "nl" ; obo:IAO_0000412 ; a obo:UO_0000095, owl:NamedIndividual ; rdfs:label "nanoliter" . obo:UO_0000103 obo:IAO_0000111 "picoliter" ; obo:IAO_0000115 "A volume unit which is equal to 10^[-12] L." ; obo:IAO_0000118 "pl" ; obo:IAO_0000412 ; a obo:UO_0000095, owl:NamedIndividual ; rdfs:label "picoliter" . obo:UO_0000105 obo:IAO_0000111 "frequency unit" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "frequency unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000106 obo:IAO_0000111 "hertz" ; obo:IAO_0000115 "A frequency unit which is equal to 1 complete cycle of a recurring phenomenon in 1 second." ; obo:IAO_0000412 ; a obo:UO_0000105, owl:NamedIndividual ; rdfs:label "hertz" . obo:UO_0000163 obo:IAO_0000111 "mass percentage" ; obo:IAO_0000115 "A dimensionless concentration unit which denotes the mass of a substance in a mixture as a percentage of the mass of the entire mixture." ; obo:IAO_0000118 "% w/w", "percent weight pr weight" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "mass percentage" . obo:UO_0000164 obo:IAO_0000111 "mass volume percentage" ; obo:IAO_0000115 "A dimensionless concentration unit which denotes the mass of the substance in a mixture as a percentage of the volume of the entire mixture." ; obo:IAO_0000118 "% w/v", "percent vol per vol" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "mass volume percentage" . obo:UO_0000165 obo:IAO_0000111 "volume percentage" ; obo:IAO_0000115 "A dimensionless concentration unit which denotes the volume of the solute in mL per 100 mL of the resulting solution." ; obo:IAO_0000118 "% v/v", "percent vol per vol" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "volume percentage" . obo:UO_0000175 obo:IAO_0000111 "gram per liter" ; obo:IAO_0000115 "A mass unit density which is equal to mass of an object in grams divided by the volume in liters." ; obo:IAO_0000118 "g per L", "g/L" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "gram per liter" . obo:UO_0000176 obo:IAO_0000111 "milligram per milliliter" ; obo:IAO_0000115 "A mass unit density which is equal to mass of an object in milligrams divided by the volume in milliliters." ; obo:IAO_0000118 "mg per ml", "mg/ml" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "milligram per milliliter" . obo:UO_0000195 obo:IAO_0000111 "degree Fahrenheit" ; obo:IAO_0000115 "A temperature unit which is equal to 5/9ths of a kelvin. Negative 40 degrees Fahrenheit is equal to negative 40 degrees Celsius." ; obo:IAO_0000412 ; a obo:UO_0000005, owl:NamedIndividual ; rdfs:label "degree Fahrenheit" . obo:UO_0000196 obo:IAO_0000111 "pH" ; obo:IAO_0000115 "A dimensionless concentration notation which denotes the acidity of a solution in terms of activity of hydrogen ions (H+)." ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "pH" . obo:UO_0000207 obo:IAO_0000111 "milliliter per liter" ; obo:IAO_0000115 "A volume per unit volume unit which is equal to one millionth of a liter of solute in one liter of solution." ; obo:IAO_0000118 "ml per L", "ml/l" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "milliliter per liter" . obo:UO_0000208 obo:IAO_0000111 "gram per deciliter" ; obo:IAO_0000115 "A mass density unit which is equal to mass of an object in grams divided by the volume in deciliters." ; obo:IAO_0000118 "g/dl" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "gram per deciliter" . obo:UO_0000212 obo:IAO_0000111 "colony forming unit per volume" ; obo:IAO_0000115 "A concentration unit which a measure of viable bacterial numbers in a given volume." ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "colony forming unit per volume" . obo:UO_0000270 obo:IAO_0000111 "volumetric flow rate unit" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "volumetric flow rate unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000271 obo:IAO_0000111 "microliters per minute" ; obo:IAO_0000115 "A volumetric flow rate unit which is equal to one microliter volume through a given surface in one minute." ; obo:IAO_0000412 ; a obo:UO_0000270, owl:NamedIndividual ; rdfs:label "microliters per minute" . obo:UO_0000280 obo:IAO_0000111 "rate unit" ; obo:IAO_0000412 ; a owl:Class ; rdfs:label "rate unit" ; rdfs:subClassOf obo:IAO_0000003 . obo:UO_0000281 obo:IAO_0000111 "count per nanomolar second" ; obo:IAO_0000115 "A rate unit which is equal to one over one nanomolar second." ; obo:IAO_0000412 ; a obo:UO_0000280, owl:NamedIndividual ; rdfs:label "count per nanomolar second" . obo:UO_0000282 obo:IAO_0000111 "count per molar second" ; obo:IAO_0000115 "A rate unit which is equal to one over one molar second." ; obo:IAO_0000412 ; a obo:UO_0000280, owl:NamedIndividual ; rdfs:label "count per molar second" . obo:UO_0000284 obo:IAO_0000111 "count per nanomolar" ; obo:IAO_0000115 "A rate unit which is equal to one over one nanomolar." ; obo:IAO_0000412 ; a obo:UO_0000280, owl:NamedIndividual ; rdfs:label "count per nanomolar" . obo:UO_0000285 obo:IAO_0000111 "count per molar" ; obo:IAO_0000115 "A rate unit which is equal to one over one molar." ; obo:IAO_0000412 ; a obo:UO_0000280, owl:NamedIndividual ; rdfs:label "count per molar" . obo:UO_0000301 obo:IAO_0000111 "microgram per liter" ; obo:IAO_0000115 "A mass unit density which is equal to mass of an object in micrograms divided by the volume in liters." ; obo:IAO_0000118 "ng/ml", "ug/L" ; obo:IAO_0000412 ; a obo:UO_0000051, owl:NamedIndividual ; rdfs:label "microgram per liter" . obo:UPHENO_0001001 obo:IAO_0000116 "Stub node that gathers root classes from various taxon-specific phenotype ontologies, as connectors to bringing classes from these ontolgies into the GENO framework." ; a owl:Class ; rdfs:comment """1. From OGMS: A (combination of) quality(ies) of an organism determined by the interaction of its genetic make-up and environment that differentiates specific instances of a species from other instances of the same species (from OGMS, and used in OBI, but treatment as a quality is at odds with previous OBI discussions and their treatemnt of 'comparative phenotype assessment, where a phenotype is described as a quality or disposition) 2. From OBI calls: quality or disposition inheres in organism or part of an organism towards some growth environment""" ; rdfs:label "Phenotype", "phenotype"@en ; rdfs:subClassOf obo:PATO_0000001 . obo:WBPhenotype_0000886 obo:IAO_0000115 "Animals exhibit variations compared to a given control." ; obo:IAO_0000116 "'Variant' is the given label of the root class in the Worm Phenotype ontology. Renamng it here to be consisent with our hierarchy of phenotype classes." ; obo:IAO_0000118 "Variant", "c. elegans phenotype" ; a owl:Class ; rdfs:label "worm phenotype"@en ; rdfs:subClassOf obo:UPHENO_0001001 . obo:ZP_0000199 a owl:Class ; rdfs:label "abnormal(ly) malformed endocardium cell"@en ; rdfs:subClassOf obo:GENO_0000575 . obo:ZP_0000386 a owl:Class ; rdfs:label "abnormal(ly) absent dorso-rostral cluster"@en ; rdfs:subClassOf obo:GENO_0000575 . obo:ZP_0000755 a owl:Class ; rdfs:label "abnormal(ly) disrupted diencephalon development"@en ; rdfs:subClassOf obo:GENO_0000575 . obo:ZP_0005531 a owl:Class ; rdfs:label "abnormal(ly) disrupted neutrophil aggregation"@en ; rdfs:subClassOf obo:GENO_0000575 . obo:ZP_0005692 a owl:Class ; rdfs:label "abnormal(ly) absent adaxial cell" ; rdfs:subClassOf obo:GENO_0000575 . geno:agr_zyg obo:IAO_0000115 "Set of zygosity terms for the Alliance of Genome Resources, used for AGM metadata" ; a owl:AnnotationProperty ; rdfs:label "agr_zyg" ; rdfs:subPropertyOf oboInOwl:SubsetProperty . dce:description """GENO is an OWL model of genotypes, their more fundamental sequence components, and links to related biological and experimental entities. At present many parts of the model are exploratory and set to undergo refactoring. In addition, many classes and properties have GENO URIs but are place holders for classes that will be imported from an external ontology (e.g. SO, ChEBI, OBI, etc). Furthermore, ongoing work will implement a model of genotype-to-phenotype associations. This will support description of asserted and inferred relationships between a genotypes, phenotypes, and environments, and the evidence/provenance behind these associations. Documentation is under development as well, and for now a slidedeck is available at http://www.slideshare.net/mhb120/brush-icbo-2013""" ; dce:title "GENO ontology" ; dcterms:license ; a owl:Ontology ; owl:versionIRI ; owl:versionInfo "2025-07-25" . dce:contributor a owl:AnnotationProperty . dce:coverage a owl:AnnotationProperty . dce:creator a owl:AnnotationProperty . dce:date a owl:AnnotationProperty . dce:description dce:description """Description may include but is not limited to: an abstract, table of contents, reference to a graphical representation of content or a free-text account of the content."""@en-us ; a owl:AnnotationProperty ; rdfs:comment "An account of the content of the resource."@en-us ; rdfs:isDefinedBy ; rdfs:label "Description", "Description"@en-us . dce:format a owl:AnnotationProperty . dce:identifier a owl:AnnotationProperty . dce:language a owl:AnnotationProperty . dce:publisher a owl:AnnotationProperty . dce:relation a owl:AnnotationProperty . dce:rights a owl:AnnotationProperty . dce:source a owl:AnnotationProperty . dce:subject a owl:AnnotationProperty . dce:title dce:description """ Typically, a Title will be a name by which the resource is formally known. """@en-us ; a owl:AnnotationProperty ; rdfs:comment "A name given to the resource."@en-us ; rdfs:isDefinedBy ; rdfs:label "Title", "Title"@en-us . dce:type a owl:AnnotationProperty . dcterms:license obo:IAO_0000117 "Mark Miller" ; dce:date "2018-05-11T13:47:29Z"^^xsd:dateTime ; a owl:AnnotationProperty . dcterms:source a owl:AnnotationProperty . dcterms:title a owl:AnnotationProperty . a owl:Class ; rdfs:label "association"@en ; rdfs:subClassOf obo:IAO_0000030 . a owl:ObjectProperty ; rdfs:label "association has object"@en . a owl:ObjectProperty ; rdfs:label "association has predicate"@en . a owl:ObjectProperty ; rdfs:label "association has subject"@en . oboInOwl:ObsoleteProperty a owl:ObjectProperty . oboInOwl:SubsetProperty a owl:AnnotationProperty . oboInOwl:created_by a owl:AnnotationProperty . oboInOwl:creation_date a owl:AnnotationProperty . oboInOwl:hasBroadSynonym obo:IAO_0000115 "An alternative label for a class or property which has a more general meaning than the preferred name/primary label." ; obo:IAO_0000117 ; obo:IAO_0000233 "https://github.com/information-artifact-ontology/ontology-metadata/issues/18" ; a owl:AnnotationProperty ; rdfs:label "has broad synonym"@en ; rdfs:seeAlso "https://github.com/information-artifact-ontology/ontology-metadata/issues/18" ; rdfs:subPropertyOf obo:IAO_0000118 . oboInOwl:hasDbXref obo:IAO_0000112 "disease characteristic (MONDO:0021125) has cross-reference (http://www.geneontology.org/formats/oboInOwl#hasDbXref) \"NCIT:C41009\"^^xsd:string" ; obo:IAO_0000115 "An annotation property that links an ontology entity or a statement to a prefixed identifier or URI." ; a owl:AnnotationProperty ; rdfs:label "database_cross_reference", "has cross-reference" . oboInOwl:hasExactSynonym obo:IAO_0000115 "An alternative label for a class or property which has the exact same meaning than the preferred name/primary label." ; obo:IAO_0000117 ; obo:IAO_0000233 "https://github.com/information-artifact-ontology/ontology-metadata/issues/20" ; a owl:AnnotationProperty ; rdfs:label "has exact synonym"@en ; rdfs:seeAlso "https://github.com/information-artifact-ontology/ontology-metadata/issues/20" ; rdfs:subPropertyOf obo:IAO_0000118 . oboInOwl:hasNarrowSynonym obo:IAO_0000115 "An alternative label for a class or property which has a more specific meaning than the preferred name/primary label." ; obo:IAO_0000117 ; obo:IAO_0000233 "https://github.com/information-artifact-ontology/ontology-metadata/issues/19" ; a owl:AnnotationProperty ; rdfs:label "has narrow synonym"@en, "has_narrow_synonym" ; rdfs:seeAlso "https://github.com/information-artifact-ontology/ontology-metadata/issues/19" ; rdfs:subPropertyOf obo:IAO_0000118 . oboInOwl:hasRelatedSynonym obo:IAO_0000115 "An alternative label for a class or property that has been used synonymously with the primary term name, but the usage is not strictly correct." ; obo:IAO_0000117 ; obo:IAO_0000233 "https://github.com/information-artifact-ontology/ontology-metadata/issues/21" ; a owl:AnnotationProperty ; rdfs:label "has related synonym"@en ; rdfs:seeAlso "https://github.com/information-artifact-ontology/ontology-metadata/issues/21" ; rdfs:subPropertyOf obo:IAO_0000118 . oboInOwl:inSubset a owl:AnnotationProperty . obo:IAO_0000114 obo:GENO_0000514 ; a owl:Class ; rdfs:comment "Equivalent to: http://www.informatics.jax.org/marker/MGI:98297" ; rdfs:label "mus musculus shh gene" ; rdfs:subClassOf obo:GENO_0000057 . obo:IAO_0000114 obo:GENO_0000514 ; oboInOwl:hasDbXref "http://zfin.org/ZDB-GENE-980526-166" ; a owl:Class ; rdfs:label "danio rerio shha gene" ; rdfs:subClassOf obo:GENO_0000047 . obo:IAO_0000114 obo:GENO_0000514 ; oboInOwl:hasDbXref "http://zfin.org/ZDB-GENE-040123-1" ; a owl:Class ; rdfs:label "danio rerio cdkn1ca gene" ; rdfs:subClassOf obo:GENO_0000047 . obo:IAO_0000114 obo:GENO_0000514 ; a owl:Class ; rdfs:comment """Equivalent to: http://www.ensembl.org/Gene/Summary?g=ENSG00000164690 Codes for: http://www.uniprot.org/uniprot/Q15465""" ; rdfs:label "homo sapiens SHH gene"@en ; rdfs:subClassOf obo:GENO_0000054 . rdfs:label a owl:AnnotationProperty . xsd:date a rdfs:Datatype . xsd:string a rdfs:Datatype . owl:Thing a owl:Class . a owl:NamedIndividual . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . a swrl:Variable . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002211 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0012011 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0012012 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002212 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002213 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002212 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002212 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0019002 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0019001 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002212 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002213 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002212 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002411 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002264 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002263 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002411 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002411 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0012011 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002180 ] [ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate obo:BFO_0000015 ] [ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate obo:BFO_0000015 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002018 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate obo:BFO_0000016 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000053 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000091 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate obo:BFO_0000019 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000053 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000086 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate obo:BFO_0000023 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000053 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000087 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate obo:BFO_0000034 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000053 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0000085 ] ) . [] a swrl:Imp ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002578 ] [ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate obo:GO_0016301 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002333 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002333 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002447 ] ) . [] a swrl:Imp ; rdfs:label "inferring direct neg reg edge from input to regulatory subfunction" ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002352 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002333 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002014 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002630 ] ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred condition associations 'down' a genotype partonomy just from a sex-qualified intrinsic genotype to the immediate sex-agnostic intrinsic genotype. (An additional property chain is needed to then propagate to the intrinsic genotype components)" ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000661 obo:RO_0003303 ) . [] a swrl:Imp ; rdfs:label "inferring direct positive reg edge from input to regulatory subfunction" ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002352 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002333 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002015 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002629 ] ) . [] a swrl:Imp ; rdfs:label "effector input is compound function input" ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002025 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002233 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002233 ] ) . [] a owl:Axiom ; rdfs:comment """This is a case of inter-gneotype phenotype propagation, requiring propagation down oen genotype and then up another. Given the data in hand, however, the conditions for this will likely never occur, so probably ok not to have this chain. This property chain propagates a phenotype asserted on a sex-qualified intrinsic genotype, down to its sex-agnostic genotype part, and then up to a parent effective genotype that has it as a variant part. I think this is OK in all cases, so we can implement this as the one case where we can have inter-genotype pheno propagation. But as noted, there will likely be no data that actually meets criteria to use this chain, so we can probably leave it out.""" ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000382 obo:GENO_0000661 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred condition associations 'up' a genotype partonomy in the direction of sequence alteration -> VL -> VSLC -> GVC -> genotype." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000382 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred condition associations from an effective genotype through a sex-qualified intrinsic genotype, through a sex-agnostic intrinsic genotype, to the coompnent variant parts of this sex-agnostic genotype." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000383 obo:GENO_0000661 obo:GENO_0000383 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment """Property chain to propagate inferred condition associations 'down' a genotype partonomy from a sex-qualified intrinsic genotype to the components of a sex-agnostic intrinsic genotype. This chain in particuular is needed to get the conditions to move past the sex-agnostic genotype and down to its parts. The following shorter chain would also suffice here: is_variant_part_of o inferred_to_cause_condition""" ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000383 obo:GENO_0000661 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred condition associations 'down' a genotype partonomy in the direction of genotype -> GVC -> VSLC -> VL -> sequence alteration." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000383 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred condition associations from an effective genotype through a sex-qualified intrinsic genotype, through a sex-agnostic intrinsic genotype, through the coompnent variant parts of this sex-agnostic genotype, and to the affected gene." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000413 obo:GENO_0000383 obo:GENO_0000661 obo:GENO_0000383 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment """Property chain to propagate inferred condition associations 'down' a genotype partonomy from a sex-qualified intrinsic genotype to the components of a sex-agnostic intrinsic genotype. This chain in particuular is needed to get the conditions to propagate to genes. The shorter chain below would also suffice for this propagation: has_allele o inferred_to_cause_condition""" ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000413 obo:GENO_0000383 obo:GENO_0000661 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment """Property chain to propagate inferred condition associations from an sequence alteration through the variant locus to a gene class. (separate chains are needed to propagate from the variant locus to the gene class, and another to propagate from a genotype, GVC, or VSLC to the gene class). NOTE that i dont need this property chain if I have a property chain to infer a has_affected_locus link from a sequence alteration to a gene when the link is asserted from the variant locus to the gene: is_variant_part_of o has_affected_locus --> has_affected_locus""" ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000445 obo:GENO_0000382 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment """Obsolete comment: Property chain to propagate inferred condition associations from an intrinsic genotype, GC, or VLSC to a gene class. (a separate chain is needed to propagate from the variant locus to the gene class, and another to propagate from a sequence alteration to the gene class). The following, shorter chain, would also suffice here: has_allele o inferred_to_cause_condition -> inferred_to_cause_condition""", """Property chain to propagate inferred condition associations from an intrinsic genotype, GVC, or VLSC to an affected gene class, or from an extrinsic gneotype or component to an affected gene class. The following, shorter chain, would also suffice here: has_affected_locus o inferred_to_cause_condition -> inferred_to_cause_condition Note that a separate chain is needed to propagate from the variant locus to the gene class, and another to propagate from a sequence alteration to the gene class in cases where the link to gene is through the variant locus rather than the seq alteration).""" ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000445 obo:GENO_0000383 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred condition associations from a variant locus instance to a gene class (to support cases where the phenotype association is made directly at the level of the variant locus/allele)." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000445 obo:RO_0003303 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred condition associations from an effective genotype through a sex-qualified intrinsic genotype to a sex-agnostic intrinsic genotype." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000791 ; owl:annotatedTarget (obo:GENO_0000661 obo:GENO_0000383 obo:RO_0003303 ) . [] oboInOwl:hasDbXref ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:RO_0002023 ; owl:annotatedTarget "Process(P2) is directly negatively regulated by process(P1) iff: P1 negatively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding negatively regulates the kinase activity (P2) of protein B then P2 directly negatively regulated by P1." . [] oboInOwl:hasDbXref ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:RO_0002024 ; owl:annotatedTarget "Process(P2) is directly postively regulated by process(P1) iff: P1 positively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding positively regulates the kinase activity (P2) of protein B then P2 is directly postively regulated by P1." . [] oboInOwl:hasDbXref ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:RO_0002025 ; owl:annotatedTarget "A 'has effector activity' B if A and B are GO molecular functions (GO_0003674), A 'has component activity' B and B is the effector (output function) of B. Each compound function has only one effector activity." . [] oboInOwl:hasDbXref "https://en.wikipedia.org/wiki/Causality" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:RO_0002410 ; owl:annotatedTarget "relation that links two events, processes, states, or objects such that one event, process, state, or object (a cause) contributes to the production of another event, process, state, or object (an effect) where the cause is partly or wholly responsible for the effect, and the effect is partly or wholly dependent on the cause." . [] obo:IAO_0010000 ; a owl:Axiom ; rdfs:comment "per discussion with Barry Smith" ; rdfs:seeAlso ; owl:annotatedProperty obo:IAO_0000116 ; owl:annotatedSource obo:BFO_0000001 ; owl:annotatedTarget "Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000001 ; owl:annotatedTarget "An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000116 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "(forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "(forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "(forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000002 ; owl:annotatedTarget "(forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; rdfs:comment "per discussion with Barry Smith" ; owl:annotatedProperty obo:IAO_0000116 ; owl:annotatedSource obo:BFO_0000003 ; owl:annotatedTarget "Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process."@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000116 ; owl:annotatedSource obo:BFO_0000003 ; owl:annotatedTarget "Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame." . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000003 ; owl:annotatedTarget "An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000003 ; owl:annotatedTarget "Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000003 ; owl:annotatedTarget "b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000003 ; owl:annotatedTarget "(forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000003 ; owl:annotatedTarget "(forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:BFO_0000004 ; owl:annotatedTarget "b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000004 ; owl:annotatedTarget "For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000004 ; owl:annotatedTarget "For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000004 ; owl:annotatedTarget "(forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000004 ; owl:annotatedTarget "(forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000004 ; owl:annotatedTarget "(iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:BFO_0000015 ; owl:annotatedTarget "p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000015 ; owl:annotatedTarget "(iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000016 ; owl:annotatedTarget "b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000016 ; owl:annotatedTarget "If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000016 ; owl:annotatedTarget "(forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000016 ; owl:annotatedTarget "(forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000017 ; owl:annotatedTarget "To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000017 ; owl:annotatedTarget "All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000017 ; owl:annotatedTarget "(forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000017 ; owl:annotatedTarget "(forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000019 ; owl:annotatedTarget "a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000019 ; owl:annotatedTarget "If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000019 ; owl:annotatedTarget "(forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000019 ; owl:annotatedTarget "(forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:BFO_0000020 ; owl:annotatedTarget "b is a relational specifically dependent continuant = Def. b is a specifically dependent continuant and there are n > 1 independent continuants c1, … cn which are not spatial regions are such that for all 1 i < j n, ci and cj share no common parts, are such that for each 1 i n, b s-depends_on ci at every time t during the course of b’s existence (axiom label in BFO2 Reference: [131-004])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:BFO_0000020 ; owl:annotatedTarget "b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; rdfs:comment "per discussion with Barry Smith" ; owl:annotatedProperty obo:IAO_0000116 ; owl:annotatedSource obo:BFO_0000020 ; owl:annotatedTarget "Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc."@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000020 ; owl:annotatedTarget "(iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000020 ; owl:annotatedTarget "(iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000023 ; owl:annotatedTarget "b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000023 ; owl:annotatedTarget "(forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:BFO_0000031 ; owl:annotatedTarget "b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000031 ; owl:annotatedTarget "(iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000600 ; owl:annotatedSource obo:BFO_0000040 ; owl:annotatedTarget "A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000040 ; owl:annotatedTarget "Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000601 ; owl:annotatedSource obo:BFO_0000040 ; owl:annotatedTarget "every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002])"@en . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000040 ; owl:annotatedTarget "(forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000040 ; owl:annotatedTarget "(forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] " . [] obo:IAO_0010000 ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000602 ; owl:annotatedSource obo:BFO_0000040 ; owl:annotatedTarget "(forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] " . [] oboInOwl:hasDbXref "CARO:mah" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:CL_0000000 ; owl:annotatedTarget "A material entity of anatomical origin (part of or deriving from an organism) that has as its parts a maximally connected cell compartment surrounded by a plasma membrane." . [] oboInOwl:hasDbXref "DOI:10.1186/2041-1480-4-43" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:ENVO_01000254 ; owl:annotatedTarget "A system which has the disposition to environ one or more material entities." . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations 'up' a genotype partonomy in the direction of sequence alteration -> VL -> VSLC -> GVC -> genotype." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000382 obo:GENO_0000743 ) . [] a owl:Axiom ; rdfs:comment "MGI uses this term when zygosity is not known." ; owl:annotatedProperty obo:IAO_0000118 ; owl:annotatedSource obo:GENO_0000137 ; owl:annotatedTarget "indeterminite zygosity" . [] a owl:Axiom ; rdfs:comment "(this is how the GVF10 format/standard refers to loci without enough data to make an accurate call . . . see http://www.sequenceontology.org/resources/gvf.html#quick_gvf_examples)" ; owl:annotatedProperty obo:IAO_0000118 ; owl:annotatedSource obo:GENO_0000137 ; owl:annotatedTarget "no-call zygosity" . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations 'down' a genotype partonomy from a sex-qualified intrinsic genotype to the components of a sex-agnostic intrinsic genotype." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000383 obo:GENO_0000661 obo:GENO_0000743 ) . _:genid505 a owl:Class, owl:Restriction ; owl:intersectionOf (obo:GENO_0000481 [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000481 ] ) ; owl:onProperty obo:GENO_0000896 ; owl:someValuesFrom xsd:string . ( ) . _:genid510 a owl:Class, owl:Restriction ; owl:intersectionOf (obo:GENO_0000014 [ a owl:Restriction ; owl:onProperty obo:GENO_0000683 ; owl:someValuesFrom obo:GENO_0000036 ] ) ; owl:onProperty obo:GENO_0000726 ; owl:someValuesFrom obo:GENO_0000481 . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations 'down' a genotype partonomy in the direction of genotype -> GVC -> VSLC -> VL -> sequence alteration." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000383 obo:GENO_0000743 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations from an intrinsic genotype component (e.g. a (sequence-)variant locus instance) to a gene class." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000413 obo:GENO_0000383 obo:GENO_0000743 ) . _:genid553 a owl:Restriction ; owl:onProperty obo:GENO_0000207, obo:GENO_0000580 ; owl:someValuesFrom obo:ENVO_01000254, obo:GENO_0000910 . _:genid555 a owl:Restriction ; owl:onProperty obo:GENO_0000248, obo:GENO_0000580 ; owl:someValuesFrom obo:SO_0000340, [ a owl:Class ; owl:intersectionOf (obo:GO_0032502 [ a owl:Class ; owl:intersectionOf ([ a owl:Restriction ; owl:onProperty obo:RO_0002091 ; owl:someValuesFrom obo:UBERON_0000105 ] [ a owl:Restriction ; owl:onProperty obo:RO_0002093 ; owl:someValuesFrom obo:UBERON_0000105 ] ) ] ) ] . [] obo:GENO_0000834 true ; a owl:Axiom ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:GENO_0000702 ; owl:annotatedTarget _:genid505 . [] obo:IAO_0000116 "In the VMC model, the notion of a GENO:biological sequence is called the 'state' of an allele." ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000118 ; owl:annotatedSource obo:GENO_0000702 ; owl:annotatedTarget "state" . [] obo:GENO_0000834 true ; a owl:Axiom ; rdfs:comment "This axiom is an initial attempt to formalize the identity criteria of an extrinnsic context that separates qualified sequence features from sequence features (i.e. the context of its material bearer). As we further develop our efforts here this will get refined and more precise." ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:GENO_0000714 ; owl:annotatedTarget _:genid508 . [] obo:GENO_0000834 true ; a owl:Axiom ; rdfs:comment "Formalizes one identity criteria of the sequence feature component of a qualified sequence feature (which itself is identified by its sequence and its genomic position)." ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:GENO_0000714 ; owl:annotatedTarget _:genid510 . _:genid565 a owl:Restriction ; owl:onProperty obo:RO_0002351, ; owl:someValuesFrom obo:GENO_0000714, obo:UPHENO_0001001 . _:genid567 a owl:Class, owl:Restriction ; owl:onProperty ; owl:someValuesFrom [ a owl:Class ; owl:unionOf (obo:GENO_0000536 [ a owl:Restriction ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:GENO_0000536 ] ) ] ; owl:unionOf (obo:GENO_0000516 obo:SO_0001026 ) . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations from a (sequence-)variant locus instance to a gene class (to support cases where the phenotype association is made at the level of the variant gene locus)." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000413 obo:GENO_0000743 ) . [] obo:GENO_0000834 true ; a owl:Axiom ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:GENO_0000833 ; owl:annotatedTarget _:genid553 . [] obo:GENO_0000834 true ; a owl:Axiom ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:GENO_0000833 ; owl:annotatedTarget _:genid555 . [] obo:GENO_0000834 true ; a owl:Axiom ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:GENO_0000833 ; owl:annotatedTarget _:genid565 . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations from an extrinnsic genotype component (e.g. a expression-variant gene instance) to a gene class." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000449 obo:GENO_0000383 obo:GENO_0000743 ) . [] obo:GENO_0000834 true ; a owl:Axiom ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:GENO_0000833 ; owl:annotatedTarget _:genid567 . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations from an expression-variant gene instance to a gene class (to support cases where the phenotype association is made at the level of the expression-variant gene)." ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000449 obo:GENO_0000743 ) . [] oboInOwl:hasDbXref "GOC:pdt" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:GO_0003674 ; owl:annotatedTarget "A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs." . [] oboInOwl:hasDbXref "GOC:pdt" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:GO_0008150 ; owl:annotatedTarget "A biological process is the execution of a genetically-encoded biological module or program. It consists of all the steps required to achieve the specific biological objective of the module. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence." . [] oboInOwl:hasDbXref "ISBN:0198506732" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:GO_0016301 ; owl:annotatedTarget "Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule." . [] a owl:Axiom ; rdfs:label "FN3KRP phosphorylates PsiAm, RibAm" ; owl:annotatedProperty oboInOwl:hasDbXref ; owl:annotatedSource obo:GO_0016301 ; owl:annotatedTarget "Reactome:R-HSA-6788855" . [] a owl:Axiom ; rdfs:label "FN3K phosphorylates ketosamines" ; owl:annotatedProperty oboInOwl:hasDbXref ; owl:annotatedSource obo:GO_0016301 ; owl:annotatedTarget "Reactome:R-HSA-6788867" . [] a owl:Axiom ; rdfs:comment "Property chain to propagate inferred phenotype associations 'down' a genotype partonomy just from a sex-qualified intrinsic genotype to the immediate sex-agnostic intrinsic genotype. (An additional property chain is needed to then propagate to the intrinsic genotype components)" ; owl:annotatedProperty owl:propertyChainAxiom ; owl:annotatedSource obo:GENO_0000740 ; owl:annotatedTarget (obo:GENO_0000661 obo:GENO_0000743 ) . _:genid873 a owl:Restriction ; owl:onProperty obo:GENO_0000239, obo:OBI_0000299 ; owl:someValuesFrom obo:GENO_0000702, obo:OBI_0000648 . _:genid875 a owl:Restriction ; owl:onProperty obo:GENO_0000903, obo:OBI_0000417 ; owl:someValuesFrom obo:GENO_0000815, obo:OBI_0200178 . [] oboInOwl:hasDbXref "PATOC:GVG" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:PATO_0000001 ; owl:annotatedTarget "A dependent entity that inheres in a bearer by virtue of how the bearer is related to other entities" . [] obo:GENO_0000834 true ; a owl:Axiom ; rdfs:comment "Formalizes the first identity criteria for a sequence feature of its sequence." ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:SO_0000110 ; owl:annotatedTarget _:genid873 . [] obo:GENO_0000834 true ; a owl:Axiom ; rdfs:comment "Formalizes the second identify criteiria for a sequence feature of its genomic position. We use the FALDO model to represent positional information, which links features to positional information through an instance of a Region class that represents the mapping of the feature onto some reference sequence. (But features can also be linked to Positions directly through the location property)." ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource obo:SO_0000110 ; owl:annotatedTarget _:genid875 . [] oboInOwl:hasDbXref "CARO:0000003" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:UBERON_0000061 ; owl:annotatedTarget "Material anatomical entity that is a single connected structure with inherent 3D shape generated by coordinated expression of the organism's own genome." . [] oboInOwl:hasDbXref "http://orcid.org/0000-0001-9114-8737" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:UBERON_0000465 ; owl:annotatedTarget "Anatomical entity that has mass." . [] oboInOwl:hasDbXref "FMA:62955", "http://orcid.org/0000-0001-9114-8737" ; a owl:Axiom ; owl:annotatedProperty obo:IAO_0000115 ; owl:annotatedSource obo:UBERON_0001062 ; owl:annotatedTarget "Biological entity that is either an individual member of a biological species or constitutes the structural organization of an individual member of a biological species." . [] a owl:Axiom ; rdfs:comment "Initially created such that integrated transgene infers as child of sequence_alteration." ; owl:annotatedProperty rdfs:subClassOf ; owl:annotatedSource [ a owl:Restriction ; rdfs:subClassOf obo:SO_0001059 ; owl:onProperty obo:BFO_0000050 ; owl:someValuesFrom obo:SO_0001059 ] ; owl:annotatedTarget obo:SO_0001059 . [] a owl:Restriction ; rdfs:subClassOf [ a owl:Class ; owl:unionOf ([ a owl:Restriction ; owl:onProperty obo:RO_0000056 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0002418 ; owl:someValuesFrom obo:BFO_0000015 ] ] [ a owl:Restriction ; owl:onProperty obo:RO_0002215 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0000056 ; owl:someValuesFrom [ a owl:Restriction ; owl:onProperty obo:RO_0002418 ; owl:someValuesFrom obo:BFO_0000015 ] ] ] ) ] ; owl:onProperty obo:RO_0002566 ; owl:someValuesFrom obo:BFO_0000040 . [] a owl:AllDisjointClasses ; owl:members (obo:BFO_0000004 obo:BFO_0000020 obo:BFO_0000031 ) . [] a owl:AllDifferent ; owl:distinctMembers (obo:IAO_0000120 obo:IAO_0000121 obo:IAO_0000122 obo:IAO_0000123 obo:IAO_0000124 obo:IAO_0000125 obo:IAO_0000423 obo:IAO_0000428 ) . [] a owl:AllDifferent ; owl:distinctMembers (obo:IAO_0000226 obo:IAO_0000227 obo:IAO_0000228 obo:IAO_0000229 ) . [] a swrl:Imp ; rdfs:label "Input of effector is input of its parent MF" ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002025 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002233 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002233 ] ) . [] a swrl:Imp ; rdfs:label "if effector directly negatively regulates X, its parent MF directly negatively regulates X" ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002630 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002025 ] ) ; swrl:head ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002630 ] ) . [] a swrl:Imp ; rdfs:label "'causally downstream of' and 'overlaps' should be disjoint properties (a SWRL rule is required because these are non-simple properties)." ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002131 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002404 ] ) ; swrl:head ([ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate owl:Nothing ] [ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate owl:Nothing ] ) . [] a swrl:Imp ; rdfs:label "'causally upstream of' and 'overlaps' should be disjoint properties (a SWRL rule is required because these are non-simple properties)." ; swrl:body ([ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002131 ] [ a swrl:IndividualPropertyAtom ; swrl:argument1 ; swrl:argument2 ; swrl:propertyPredicate obo:RO_0002411 ] ) ; swrl:head ([ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate owl:Nothing ] [ a swrl:ClassAtom ; swrl:argument1 ; swrl:classPredicate owl:Nothing ] ) .